-
Greetings.
Here is an example of a pair of sequences which give a slightly different alignment depending on the sequence directions. In the CIGAR sequence it results in M23 on one end for one dire…
-
I'm running targetfinder with a very small sequence (DEseqs.1.fa, a 1000 bp sequence ). It seems to be running forever (20 minutes and waiting)
`./targetfinder.pl -s GGAAGAGGAUCGUUUAACUGUAGCAAGA -…
-
* Phonetic Algorithm
- Double Metaphone (Queued phonetic metric and algorithm)
- NYSIIS (Phonetic metric and algorithm)
- Refined NYSIIS (Phonetic metric and algorithm)
- Refined S…
-
I'm running PyPaSWAS as follows:
```
python3 ./implementations/warris2018/pypaswas.py -o zout --loglevel=DEBUG --outputformat=TXT -p aligner --filetype1=fasta --filetype2=fasta -O OVERRIDE_OUTPUT -M…
-
Hi~
my command is: pacasus.py --device_type=CPU --platform_name=Intel --framework=opencl part.fasta -o cleaned.fasta --loglevel=DEBUG --maximum_memory_usage 0.2
and got this error:
DEBUG - …
-
A nanopore read when mapped using minimap2 to the human genome (the whole index is in memory) gives an output as follows.
![image](https://user-images.githubusercontent.com/12987163/38192839-4333a278…
-
the only example of this I have at the moment is with respect to the new gene families defined on lis-dev, but I suspect it occurs elsewhere without my having noticed it.
Compare : repeat algorit…
-
I was trying to locate relatively unique regions from two very close bacterial genomes and needed to set a divergence less than -x asm5. Then, I encountered a segmentation fault when I set gap open pe…
-
Hello
I have recently started looking into sequence alignment algorithms in general and bwa-mem in particular. I have a basic question about the ksw_extend2 function in ksw.c in the bwa-mem codebas…
-
e.g. http://laasi.ncgr.org/mt_hapmap/gcv/#/search/mt_hapmap/medtr.HM129.v1.0.g1216?regexp=&neighbors=10&sources=mt_hapmap&alpha=0.5&kappa=10&minsup=2&minsize=5&matched=4&intermediate=5&algorithm=repea…