-
while trying to draw Annotated Chromosomes as it described in biopython tutorial it gives me the simple one without annotation with labels
I am reporting a problem with biopython-1.71, Python ver…
-
"Commander profile data file not found or unreadable."
This message always appears whenever I press the "CMDR Profile" button. I even manually edited the INI to include my CMDR name, but that still…
-
Hi,
I'm trying to run ISEScan for the NC_012624.fna that you provide.
But I'm running into an issue:
```
python3 isescan.py NC_012624.fna proteome hmm
isPredict begins at Mon Mar 26 12:32:00 20…
-
like in study/table call
See also #44
-
## I happened to install celery 4.1.0 with django_celey_beat 1.0.1, the DatabaseScheduler seems not working well.
[2017-08-07 21:12:10,790: DEBUG/MainProcess] DatabaseScheduler: Fetching database …
-
I think these are in OJS and that's why they are currently inaccessible. I thought the plan was to keep a PDF or something so that even if they are not interactive they can still be read.
I was looki…
-
After verifying that I am correctly logged in to the Utah SynbioHub Registry and going to the proper collection for my toggle switch, I am still unable to view any of my submitted parts for the toggle…
-
Files do not upload from the local machine (says 100% but never completes) when I right click on the file manager in the browser and select "Upload" > "Choose Files" from the drop-down menu.
Files …
-
I'm using this sequence (A*29:02:01:01 with truncated 5' and 3' UTR sequences that include two 5' and one 3' UTR changes) to test the act operations:
`cgcgtggctctcagagtctcaggccccgaaggcggtgtatggattg…
-
Similar as for #658 , when looking at available germplasm in a given location, all the accessions that are not linked to an experiment are not visible. Should these be optionnaly or systematically dis…