-
**Issue description**
I try to play a TS file but can not, may be have problem decode audio. VLC can play normal
Following is log message:
```
10-17 12:00:25.910 9121-9121/com.google.android…
-
I am constructing binary matrix from abricate output and I can't decide what percentages to go with. The idea was to report only genes that has >95% coverage and from that >95% identity. But I am conc…
-
Suppose a pair of PCR primer:
```
F: ACCAAACCCCAGAGTCAATTAA
R: TCTATCTATTGCACTGCCTGTTG
```
And the database is:
```
>seq1
ACTGAGAGTACAACCGCTTCTGCAATGCCAAGTCCAGCAGCAAGTGCTAAGGAAGGGAAG
AACTTTCT…
-
Hello,
When trying to use the products of an Anneal instance, _multiply_circular fails, presumably, if the sequence has a feature splitted along the sequence origin (as with NZ_CP009685.1 or NZ_CP014…
-
This protocol is currently undergoing peer review. Please use with caution. I will update this repository if/when the publication status changes
-
editor preferred term: 5' rapid amplification of cDNA ends
alternate terms: 5' RACE
textual definition: The use of reverse transcription and PCR to amplify mRNA sequence between a defined internal s…
-
While running a tutorial yesterday, we found that when lots of users submitted their sample information or prep information to their study, the database would deadlock and show this message:
In the…
-
Dear
Impressive study and R package! Thanks.
I have successfully applied the method for a few test samples and are now looking forward to try it on larger datasets.
However I have a different approa…
-
Hello,
First of all, great module!
One issue I have noticed is that pydna.cloning_primers() can generate primers that exceed maxlength.
My understanding of maxlength is that if I set it to, eg, 4…
-
This term has a full comments in REO. It should be moved to OBI.
http://purl.obolibrary.org/obo/REO\_0000826
Definition: A nucleic acid macromolecule or submolecule that is part of a cell or vir…