-
Recently, I've tried running transdecoder on a set of predicted RNA sequences, as a repeat from a similar project from earlier. However, I noticed some of my sequences had complete ORFs detected by tr…
-
Hi Brian
I'm new to Ubuntu and trying to install TransDecoder-TransDecoder-v5.3.0 on a Ubuntu 14.04 LTS After "make," I get the following error: Nothing to build. Run 'make test' to run example exec…
-
When running TransDecoder.Predict, e.g. in the following example:
`hmmscan --cpu 8 --domtblout pfam.domtblout /path/to/Pfam-A.hmm transdecoder_dir/longest_orfs.pep`
Why is the input file longest…
-
Hi. I am using the gff validation tool on some final Transdeocder output and am getting some errors. The input I started with was from PASA. I am applying Trandsdecoder to the compreh_init_build.fasta…
-
Hi,
I performed transdecoder on 13 RNA samples at first, and then included 18 more samples to perform gene prediction with transdecoder. Using the same genome( repeats unmasked), I was able to pred…
-
I have a problem that's somewhat similar to the error in #110
my command is:
cdna_alignment_orf_to_genome_orf.pl \
Trinity.fasta.transdecoder.gff3 \
Trinity.gff3 \
$TRINITY > $SAMPLE.fasta.…
-
When I run the following sequence through transdecoder, it misses a complete ORF of 204 lengths (looking at the longest_orfs.pep file):
>ENSMUST00000000305_ENSMUSG00000000296
`AAAATGAATTATTTTAATGACT…
-
Dear Brian,
I used your TransDecoder for prediction of CDS using my merged gtf file. Things looked good, until I run the last step, TransDecoder.Predict. It came with a error, although the job see…
-
## Short description of the problem
Cannot input Augustus gene calls into anvio
## anvi'o version=7.1
## System info=linux, installed via conda
## Detailed description of the issue
I wa…
-
Hi, there
I have some full-length pacbio data and want to add the UTR sequence in to the data. I used the Transdecoder to do this work. There were something wrong about the results and I am very c…