-
Hi,
I would like to know if it makes sense to use rnaseq bigwig file in hicpca to flip the signs. For example, choose extra track type --> Histone Mark --> Histone Mark type=active. Would this be a…
-
Hello, referencing #2855, I have an integrated Seurat object ("so"). I want to add additional genes to the object after integration (I don't want the additional genes to be considered when integrating…
-
Thank you very much for sharing. I found that some data was not sorted during the reproduction process. How do you handle the sorting of these data such as BMMC data how to sort？Can you provide a tuto…
-
cat test.fa
> RNA
GCGGGGGUUGCCGAGCCUGGUCAAAGGCGGGGGACUCAAGAUCCCCUCCCGUAGGGGUUCCGGGGUUCGAAUCCCCGCCCCCGCACCAUCCCCGCCCCCGCACCA
bash -x ../run_RF2NA.sh test R:test.fa
output:
+ python /home/ubuntu/…
-
Hi rMATS team,
I would like to apply rMATS on our recent RNA-seq data. During QC check of the fastq files using FastQC, I see a high level of sequence duplication (please see the attached fig). Do …
-
### Description of feature
Hi,
I recently came across Mikado which is a pipeline to identify the most useful or “best” set of transcripts from multiple transcript assemblies. Our approach leverages …
-
Hello!
I recently tried EviAnn in liftover mode following your example:
```
/path/EviAnn-X.X.X/bin/eviann.sh -t 24 -g /path/genome.fasta -e $PWD/transcripts.fa -r $PWD/proteins.faa -l
```
But the…
-
Hello!
I find the tutorial at https://satijalab.org/seurat/articles/seurat5_integration and learn that we could call harmony by the function "IntegrateLayers".
But in the example code (cop…
-
I have read in your documentation that
**_The new.prism function removes any genes in the mixture greater than 1% in more than 10% of the mixture samples by default. This threshold is very lenient…
-
The schedule generator has an option of group rows and total them up which is great, except that it will never have an identical row for something line RNA object name unless it can be set to ignore t…