-
Hello,
I'm trying to follow your MAmBA test code using the following command after downloading the files from https://sites.google.com/a/uniroma1.it/valeriofulci-eng/software :
_/mamba.sh -a TGG…
-
I am trying to quantify RNA reads from SlideSeqV2 data using a custom technology string (-x ) and a kallisto index (_version 0.50.1_) with help of the kb count (_kb_python 0.28.2_) command. The total …
-
Hi cutadapt,
I get the below output fastq when running cutadapt command (v4.2, installed via LSF module/compilation with gcc 11.3.0)
`cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAG…
-
When running DIANN there are only 1327 genes/proteins found in the FASTA file, but there are 6054 entries when I open the file or load it into Proteome discoverer or Fragpipe. Can you please explain w…
-
### Prerequisites
- [x] make sure you're are using the latest version by `taxonkit version`
- [x] read the [usage](http://bioinf.shenwei.me/taxonkit/usage/)
### Describe your issue
I am tryi…
-
Hi all again,
cc: @ThomasDesvignes @mhalushka @mlhack @keilbeck @BastianFromm @ivlachos @TJU-CMC
After giving some time to think, I realized we could ask slightly different for a solution the n…
-
## Short description of the problem
`anvi-dereplicate-genomes` fails when some genomes are not grouped in a cluster. See discord: https://discord.com/channels/1002537821212512296/120545929393209345…
-
I think it would be possible to adapt to [`TreeSummarisedExperiment`](https://github.com/fionarhuang/TreeSummarizedExperiment).
Things checked:
- It is possible to subset the `TSE` object.
- It…
-
**Describe the bug:**
binning-prokaryote fails at 7__dastools step. dastools appears to run/start but fails after calculating contig lengths.......
**Versions**
veba_binning-prokaryotic_1.4.1.s…
-
I suppose this is an extremely unlikely usecase in the first place and i can circumvent this in my work, decided to write up anyway:
I have some 3-20 nucleotide long trna/mrna fragments sprinkled i…