-
This looks like a really interesting project, but I'd like to see a tutorial that covers transitioning through from 1 node to several, along with a transaction across actors. My use case would be havi…
-
Move the logic from the `cell_main` into a clustering object that performs the clustering and writes to file (alternatively to a root file).
-
mctop run is getting aborted. lstopo and cpuinfo output has been attached.
**************************************************************************************************************
# MCTOP Sett…
-
Adapt sequence sampling throughout training so that we first train on "simpler sequences" and then on more and more "complexe" sequences. We discussed three different types of strategies depending on …
-
### Your current environment
```text
PyTorch version: 2.2.1+cu121
Is debug build: False
CUDA used to build PyTorch: 12.1
ROCM used to build PyTorch: N/A
OS: Ubuntu 20.04.2 LTS (x86_64)
GCC ve…
-
Hi Connor,
I have a subset of some data in the file test.txt. Each sequence in this fasta file contains one of two DR's which differ by only a single bp GTTCCAATTAATCTTAAACCCTA**C**TAGGGATTGAAAC vs GT…
-
@Nowosad, would these same parameters work for tuning `compactness`? And if so, would you be able to provide some guidance on how to choose the range of values to test? Adjusting the formula from your…
-
@sipa and I gave a presentation to some other developers recently about some work we've been doing to redesign how the mempool works, and I wanted to share a writeup outlining our thoughts with a broa…
-
Dear @readmanchiu
I am currently using Straglr 1.5.0 and produced the following output for the FGF14 locus. If I am correct there is a discrepancy in the sequence shown in the vcf and the AL/ALR a…
-
Like for DBSCAN it would be very useful to also have the possibility to use a "sample_weight" parameter when performing HDBSCAN clustering trough the fit method. This to take into account possible pre…