-
-
Great work, thanks for your contribution.
Can this function be used on DNA sequences? Visualizing a specific region of the genome also requires these functions.
-
Upon import (`from acoustic_toolbox import Signal`), several warnings are raised about invalid escape sequences in the `standards` docstrings, but otherwise it imports fine. Looks like it's related to…
-
hi
**issue**
***423 media_set_parse_sequences: invalid number of sequences 34 while getting mapping**
for any json file have sequences length bigger 32 clips ,any json sequences
-
## 🚀 Feature
This is a follow up to PR #710.
Currently, thunder indexing supports the following (credit to @mruberry):
- basic indexing
- advanced indexing with a sequence of 0D or 1D integ…
-
Hi,
I use abPOA to produce multiple consensus sequence, three most frequency sequences are
> 1 with a depth 25
CCCTCCCTTCCTTTCTTTCTCTCTTTCTCCCTCTCTTTCTCTTTCATTTTTCCTC
> 2 with a depth 40
CCCTTC…
-
When running the script for Step 3, the script crashes.
1) Select Standard Sequences from a chosen input structure -> 2) Select input structure -> 3) Remove chains from Standard Sequences -> crash
…
-
As suggested by Dr. Martin Hemberg following our recent email correspondence, I’d like to summarize some issues I encountered with TransposonUltimate (ReasonaTE and RFSB). I fully recognize and apprec…
-
**Describe the bug**
When creating a non-primary key column with a sequence in postgres, alembic generates the migration as expected. However, after applying that migration, and then autogenerating…
-
Hi, I have a corpus of about 500,000 protein sequences and would like to apply them to existing models like this one for predicting the evolution of monoclonal antibody binding to an epitope.
How cou…