-
Hi, StarDestroyers is running into an issue where alerts are appearing in the real time queries, but are absent in the JSON stream logs.
Is there some cadence when the stream logs run that might intr…
-
Apply indexing process of a search engine and prepare ranking based on tdf-idf.
The target search docs are the text fields of a given specialization.
Also write accompanying documentation.
-
We should report the SN types that are in the TNS on the Lasair page. Users should not have to click through.
e.g
https://lasair.roe.ac.uk/object/ZTF19abgpgyp/
Is correctly reported as being …
-
Hi LINCC,
I am working on a use case where i want to find the Panstarrs light curves for my favorite sample of something like 30 objects ( as a test case for scaling this up to half a million objects…
-
This is what should be happening. It enables queries that join the TNS table to run as streaming queries.
(1) On the head node, every 4 hours + 1 minute, the TNS service in Israel is polled, and an…
-
Hi, Bogdan and Michael @kirilenkobm @MichaelHiller,
This was originally a comment on issue #9. Then, I realize it's a separate issue.
When I tried human vs. Chimpanzee and human vs. _Macaca mul…
-
**Bug report**
`Catalog.to_hipscat()` is much slower than `Catalog._ddf.to_parquet()` for large jobs.
For example, for a smaller job, `to_hipscat()` took 100s, while `to_parquet()` took only 50s…
-
**Bug report**
If we decide to keep the non-matches it's possible to get NaN values in our crossmatch dataframe. For every point in the left partitions we will have a row with the left point inform…
-
### Description
We're currently using Android Gradle Plugin (AGP) 7.6.3. When we try to run `flutter build apk`, it throws a build error for having a nullable R8 issue, related to the AGP v8 migrat…
-
I am trying to run RepeatMasker with a custom library downloaded from a database. It's in fasta format:
```
>ORSgTETNOOT01930 gi|14578149|nt85894-86033 unclassified transposon
GGCTGCGTTTAGATCCAAAGT…