-
Hi, I want to know how can I run multiple genomes using FASTA format, because I use this command but doesn´t work.
amrfinder --plus --nucleotide *.fasta -O Streptococcus_pneumoniae > results.csv
…
-
Hi
I'm trying to extract all bacterial reads from a paired-end kraken analysis but I am getting an error when the script tries to parse the kraken.report.txt. I'm running under most recent version …
-
I get warnings when attempting to `makeSignatures` for antimicrobial resistance, length, and width:
```
Warning messages:
1: No signatures for antimicrobial resistance (categorical). Returning NU…
-
Hi,
Just wanted to flag a very minor issue. In the wiki under [--organism option](https://github.com/ncbi/amr/wiki/Running-AMRFinderPlus#--organism-option) in the `Organism Option` column `Burhkho…
-
Hello,
Hello, we have a validation issue for this test:
```
> -
>
>
> Path | Severity | Message
> -- | -- | --
> Bundle.entry[0].resource/*Composition/29389514*/.section[0].entry[0] (l4…
-
```
>c9effcbc-21fe-4869-8020-c22d0bc9bf37
TACGAACTTCGTTGAAGCAAACAGCCGTCATAAGGAAATTTTCGACAATAAATTTCGCACAGAAGAGGATCCCCAGGAAGAAGAATTTTATCAGCAATTTCACCTTGCTTAAGCGGCAATATGGATAGACATAGTTTATGATACAAAGAGCGACC…
-
Hi Arjun and team,
I have a quick question - is there a way with the executable `amrfinder` (or otherwise) to install an older version of the amrfinderplus database? For example, if I wanted to rep…
-
- [x] *Mycobacterium tuberculosis* @Shuyib
- [x] *Clostridium difficile* @Shuyib
- [x] *Stapylococcus aureus* @Shuyib
- [x] *Pseudomonas aeruginosa* @Ephantus-Wambui
- [x] *Escherichia coli…
-
-
Hey, what's happening here?
> Could not run command: cat prokka\/IS\.faa | parallel --gnu --plain -j 8 --block 88671 --recstart '>' --pipe blastp -query - -db /usr/local/prokka/db/kingdom/Bacteria/…