-
Hi, I'm very new in using bismark. Before to realize bismark alignement, I have prepared my reference genome using bismark_genome_preparation. Then I tried to realized the alignement but whatever I ha…
-
Hi,
When I try to extract methylation information on CpG, CHH and CHG motif follow the instruction of tombo documentation, like this:
`tombo preprocess annotate_raw_with_fastqs --processes 60 --o…
-
When running this I
```
atropos -T 8 \
-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o "out.1.fastq" \
-p "out.2.fastq" \
-pe1 "R1.fastq.gz" -pe2 "R2.fastq.gz…
-
I try to use DMRfinder to analyse RRBS. I don't know if it is reasonable
-
Hi - thank you for the continued development of Bismark!
We think that there may be a bug in the function paired_end_SAM_output() (https://github.com/FelixKrueger/Bismark/blob/c7521709564ad3e9c8dc1…
-
How does the extract_features function get the true label for each candidate target base?
I have been going over the code but could not figure out how it determines whether a candidate target is meth…
-
I see this error when trying to run `gemBS map`:
```
:
: Command map started at 2018-09-29 19:18:30.885616
:
: ------------ Mapping Parameters ------------
: Sample barcode : pgp1
: Data se…
-
Hi yupenghe,
Can you look into the bam-quality-filter program? It does not function as its supposed to. I am trying to use it to filter reads with very high non-CG methylation >90%. The program is …
-
Hi there is an error when running per_read_roc:
genome_fasta="/projects/li-lab/reference/hg38/hg38.fasta"
tombo plot per_read_roc \
--per-read-statistics-filenames mathylation_calls.5mC.tombo…
-
I tried to use Bismark to analyze BS-seq(paired end), but it stopped at mapping step (using Bowtie2).
The command line I used was: bismark -u 10000 --bowtie2 /ref_path/ -1 file_R1.fq -2 file_R2.f…