-
-
Se puede asumir que siempre el header vendrá en el orden: AAG, GTC, GGA, TCT, GTA, CTC, CGA, TGG, TAG?
Gracias!
-
I've been testing out KMC with the following dummy sequence
```
>dummy
AATGGGTCCCTGTTTCGCGATAAAATGCCAATCGCTCTAAATATCGCGCTAGC
```
with the command `kmc -ci0 -fm -k3 -cs300 dummy_genome.fa dummy_km…
-
-
Hi Greg,
We now have some TGGs in the testsuite that take over 20s of initialisation. This is almost as long as code generation and can surely be optimised.
Apart from optimising the process it…
-
_From @RolandKluge on October 20, 2015 17:6_
Recently, I encountered several cases where my patterns were not well-formed and the control flow validation took forever. It would be great, if the CFV c…
-
Hi Greg,
I am currently testing the performance of the flattened and the refinement pattern networks. I have written a framework that automates these tests for various model sizes and TGGs. Natural…
-
and make sure that all references in tests are to the centralised resources folders in our single test suite project.
-
-
Hi Greg,
I have a new set of test cases which sometimes throw a `Join Failed` exception. I will update the Democles-Debug branch on emoflon-ibex-tests shortly so that you have all of our current te…