-
Please make sure that you provide enough information so that we understand what your issue is about.
1. uname -a
```
$ uname -a
Linux pentoo 5.2.11-pentoo #1 SMP Thu Sep 5 10:59:13 CEST 201…
-
-
### What version of Materialize are you using?
15119a9478 (Pull Request #28191)
### What is the issue?
Seen in https://buildkite.com/materialize/nightly/builds/8533#0190ab78-992b-482c-a715-b97127ac…
-
To get more granular information beyond the counts of violations visible in the exporter data we will have to scrape violation data so we can get a better understanding of which specific pollutants we…
-
Similarly to https://github.com/confidential-containers/cloud-api-adaptor/issues/957, we would like allow the Libvirt adaptor to spin up SEV-SNP instances so that developers are able to develop featur…
-
This is the place to report bugs in the OpenProvider DNS API.
If you experience a bug, please report it in this issue.
Thanks!
-
Caught on #3318 the following failure is reproducible:
```
./gradlew ':server:test' --tests "org.opensearch.index.query.IntervalQueryBuilderTests.testMustRewrite" -Dtests.seed=A6236EB12532F6E5 -Dt…
-
Hi,
a TRGT VCF line contains multiple repeat motifs within the same allele, as shown below:
```
chr3 183712187 . CTTTTATTTTATTTTATTTTATTTTATTTTATTTTA CTTTTATTTTATTTTATTTTATTTTATTTTA…
-
Here we want to discuss the configuration settings of our EDC, both the options for configuring a CaaS and an on-premise EDC.
-
# Summary
GitHub has added their ssh keys to https://api.github.com/meta
# Motivation
A number of us suffered a major GitHub driven CI outage as covered by #7723 and temporarily fixed by #772…