-
We have a fusion called SCP2-NTRK1 and we are curious as to why the fusion is being called as out of frame. The nt sequence as reported by arriba is as follows:
```
ATAATTTAGGCATTGGAGGAGCTGTGGTTGTAA…
-
Support for encoding VP9 in an MP4 container would be useful for Discord as webm lacks native iOS support and therefore does not embed.
VP9 is natively supported and does embed on iOS when uploade…
-
```
void __attribute__((noinline)) f() { …
-
Create a video stream in Python using OpenCV (cv2)
Make it such that it can be used for a custom Gym environment (TBD what this is...)
-
```
I've come up with a fairly simple way of animating any kind of image format,
based on how sprite sheets were used back in the day. I believe most pixel
artists are familiar with sprite sheets an…
-
**Feature Request for Future Versions**:
Fill Selection Tool for areas around vector lines like these (from Krita)
![snip_20180426221417](https://user-images.githubusercontent.com/25135159/39315119-…
-
Hello Turtledove Authors,
I would like to understand Turtledove Interest group selection in the context of Header Bidding.
**Context**:
In Header bidding, Publishers request bids for an ad slot…
-
Implementation:
Design system:
[Figma link](https://www.figma.com/file/3WX8yUqa8ECmhLwV6NIF3a/Rerun-Design-System?type=design&node-id=964-5992&mode=design&t=UEwrIbrfSM5Yz0sP-0)
Behind…
-
Running into the same sort of issue as in https://github.com/ppy/osu-stable-issues/issues/207 but with some slight differences, so hopefully not a duplicate but happy to move this post if it belongs b…
-
**Version/Branch of Dear ImGui:**
Version: Dear ImGui 1.86 (18600)
Branch: master
**Back-end/Renderer/Compiler/OS**
Back-ends: imgui_impl_win32.cpp + imgui_impl_dx12.cpp
Compiler: MSVC++ 20…