-
In the function section of the protein pages, the HAMAP link (e.g. "MF_04099" in the image below) is not working
https://www.glygen.org/protein/P0DTC2-1#Function
, similar to what we use in the B…
dssib updated
3 weeks ago
-
A bare minimum would be to ingest this file:
https://ftp.expasy.org/databases/enzyme/enzclass.txt
This has more useful info including a synonymous enzyme names, description, and reaction strings (…
-
e.g., the MAP kinases are listed as entry 2.7.11.24 in the Expasy enzyme taxonomy, see https://enzyme.expasy.org/EC/2.7.11.24. Some reading systems produce groundings to this taxonomy.
-
Hi, as Prodigal v2.6.3, we observe with pyrodigal a difference in translation result for some start codon (TTG).
>nuc sequence (Lactobacillus)
TTGGGCATACCGGCTGAATACGTCTTATTCGACAGCTGTTTCTCTTCACCTAA…
-
The Cellosaurus is a manually curated knowledge resource which aims to describe all cell
lines used in biomedical research. It provides information on immortalized, naturally
immortal and finite lif…
-
I have run pfscanV3 on several sequences e.g., https://www.uniprot.org/uniprot/E8WI69.fasta and I am not getting any matches using 2020_05 prosite release.
If I use pfscan v2.3 I get the same match …
-
I was annotating PMID:1588921 (https://www.ncbi.nlm.nih.gov/pubmed/?term=1588921) and had a hard time identifying the appropriate function term for the enzyme named DHEA-ST and described as "capable o…
-
Just a heads-up in case we have Expasy links
`To improve security and privacy, we are moving our web pages and services from HTTP to HTTPS.
To give users of web services time to transition to HTTPS,…
-
Find the vocubalary that the NLM uses for PubTator. Use that vocabulary to translate CellLines in our services and to make CellLines searchable.
Maybe we also need to integrate a way to annotate Ce…