-
Refactor the base Fq field type from Fq { c0: u256 } to Fq(c0: u384). This change is motivated by the fact that the Cairo circuit calculates directly using u384. By transitioning from u256 to u384, we…
-
**Describe the bug**
It seems that montepy is not able to parse correctly FQ cards
**To Reproduce**
``` python
problem = montepy.read_input("foo.imcnp")
```
**Error Message (if any)**
…
-
**Important notices**
Before you add a new report, we ask you kindly to acknowledge the following:
- [ Y] I have read the contributing guide lines at https://github.com/opnsense/core/blob/master…
-
Some production alerts failed in this morning's scheduled run due to the contents of the fq column.
Details of each below:
1. https://lists.ala.org.au/speciesListItem/list/dr27365 has fq with tr…
-
### Package name
fq
### Brief description of package
jq for binary formats - tool, language and decoders for working with binary and text formats
### URL for package's homepage
https://github.co…
-
fastplong -w 128 -Q -i ont.fq.gz -o fastplong.fq.gz
Trying to detect adapter sequence at read start
Detected: TGTACTTCGTTCAGTTACGTATTGCT
Trying to detect adapter sequence at read end
Found possib…
-
Hi,
I want to use triocanu for haplotype assembly. For hap1, the expected coverage is 12X on a 0.6G genome (P10), while for hap2, the expected coverage is 21X (P48):
```
canu -p F1_trio -d canu_tri…
-
Let's create a new base field
`struct Fq {
c0: 384
}`
And implement the field operations trait as circuits. The files relevant will be fq_1, fq_2, fq_6, fq_12. Let's keep the old field impl…
-
fqfq，快联系我， 我是 zd，phone/wx: -
-
### Description of the bug
I have been processing tumor normal samples using sarek and I have results for 6/14 samples
The pipeline stopped and I tried re-running it but no luck. What I am trying now…