-
Hi, I'd like to use your package but I'm having issues with installation. I've followed all the steps until:
`snakemake --use-conda --conda-create-envs-only --cores 1`
But I get the following e…
-
Search for shRNA sequence GTGAAGAATGTGACAAAGTTT finds two observations, but from the search page it is not possible to go to shRNA page https://ctd2-dashboard.nci.nih.gov/dashboard/#rna/gtgaagaatgtgac…
-
I'm trying to run the blobtoolkit snakemake pipeline of and it seems like I'm getting an error each time trying to run the blastn step. I have followed the following to download the databases: https:/…
-
**Affected Projects**
React
**Is your feature request related to a problem? Please describe.**
`data` on render of MultiList doesn't make a difference between an elastic search result and a searc…
-
I've been experimenting with alternate encodings for the PCDATA tables, with the goal of significantly improving decode speed, at possibly a slight increase in binary size.
@mknyszek, @dr2chase and…
-
OpenGL render does not correctly handle the Depth merging when the depth buffer is enabled. This is because the raySurfaceTrilinear never had the depth code inserted, and it must handle it differently…
-
Sometime between episode 12 and 13, my Raycast stopped detecting hits. Any idea what is happening?
Below is the Shoot(); I added debug.logs to find the error.
[Client]
void Shoot()
…
-
### What it is?
Gizmos are great, but there's some very strange inconsistencies in how the API works.
Lets use the capsule methods as an example:
For my weapons I'm using a capsule trace to det…
-
UIC- 12/15/2017 open call - The default text when you get no results would ideally include some locally configurable text that libraries could use to help instruct their users about other options like…
-
Wrote a quick script to extract debug flag uses from the GC debug build, will probably come in handy for reimplementing them.
This doesn't include any uses inside .REL files (yet?), so there's probab…