-
Hi,
Can we perform gene imputation using cell2location ? (This is what can do with Tangram)
-
Hello,
I have a question about the deconvolution process. As I understand it, there are 2 steps: (1) segmentation by watershed algorithms that gives the cell_count and (2) deconvolution by alignment…
-
Greetings,
I am using Tangram to annotate my spatial data (10X) using single cell data. I would like to better understand the output of project_cell_annotations().
It says “INFO:root:spatial p…
-
It seems that the pipeline configuration of tangram is not correct?
> ./gkno pipe fastq-tangram -r resources/homo_sapiens/current/human_reference_v37_decoys.fa -mr resources/homo_sapiens/current/mob…
-
Integration worked in Android but not in iOS
```
Widget build(BuildContext context) {
return Scaffold(
appBar: const PreferredSize(
preferredSize: Size.fromHeight(kToolbarHeig…
-
Tested on Sept 18th, 2018 build (https://github.com/Triang3l/xenia/tree/d3d12)
# Issues:
Doesnt load at all. Just gives a white screen. The log might have something
# Log:
[xenia.zip](https…
-
- the `justfile` is outdated (should be `tangram run` for poetry)
- the `lockfile` is outdated (should run `poetry lock --no-update` and recommit)
Also, it seems the websocket is experiencing issu…
-
I am working on bam files that were generated from BWA-MEM with the output in following format:
ERR194147.232367647 65 1 9998 0 67M34S 5 18606756 0 GGATAACCCTAACCCTAACCCTAACCCTAACCCTA…
-
Add map in malayalam
https://wiki.openstreetmap.org/wiki/Kerala/Translation_Efforts#Map_in_Malayalam
https://osm-in.github.io/indic-map/#5.029687499999998/23.196/73.394
-
Some nice shaders on here. I have a variety of DeckGL layers that would look great on top of these. Has any one suceeded in interweaving the 2 frameworks?
Im trying to work out what would best deck…