Conda CircleCI GitHub

FastMLST

A multi-core Multilocus Sequence Typing tool coupled with allele concatenation.

Introduction

FastMLST is a high speed standalone script wrote in Python3, which takes assemblies in FASTA format (gzipped is also allowed) and determines its ST according to MLST schemes defined in PubMLST. The main advantage over other ST determination programs is that FastMLST allows the generation of a FASTA file containing the concatenated alleles for all analyzed genomes ready to be aligned and used in phylogenetic inference.

You can read a complete guide to MLST analysis in our Wiki.

Installation

Currently the only way to install this script is using Conda.

conda config --add channels defaults
conda config --add channels conda-forge
conda config --add channels bioconda
conda install fastmlst

Dependencies

It is expected that all dependencies will be resolved when using conda for installation.

Python > 3
Biopython
tqdm
pandas

NCBI BLAST+

Quick Start


$ fastmlst cdiff_refferences/RT078_CDM120.fasta
RT078_CDM120.fasta,cdifficile,11,adk(5),atpA(8),dxr(5),glyA(11),recA(9),sodA(11),tpi(8),mlst_clade(5.0)

$ fastmlst cdiff_refferences/RT078_CDM120.fasta.gz RT078_CDM120.fasta.gz,cdifficile,11,adk(5),atpA(8),dxr(5),glyA(11),recA(9),sodA(11),tpi(8),mlst_clade(5.0)

$ fastmlst cdiff_refferences/*.fasta RT001_BI9.fasta,cdifficile,3,adk(1),atpA(1),dxr(2),glyA(1),recA(1),sodA(1),tpi(1),mlst_clade(1.0) RT001_Liv24.fasta,cdifficile,3,adk(1),atpA(1),dxr(2),glyA(1),recA(1),sodA(1),tpi(1),mlst_clade(1.0) RT002_TL178.fasta,cdifficile,8,adk(1),atpA(1),dxr(2),glyA(6),recA(1),sodA(5),tpi(1),mlst_clade(1.0) RT012_CD630_chr_V12.fasta,cdifficile,54,adk(1),atpA(4),dxr(7),glyA(1),recA(1),sodA(3),tpi(3),mlst_clade(1.0) RT014_TL176_v3.fasta,cdifficile,13,adk(1),atpA(1),dxr(6),glyA(1),recA(5),sodA(3),tpi(1),mlst_clade(1.0) RT015_TL174.fasta,cdifficile,44,adk(2),atpA(5),dxr(2),glyA(1),recA(1),sodA(3),tpi(1),mlst_clade(1.0) RT017_CF5.fasta,cdifficile,86,adk(3),atpA(7),dxr(3),glyA(8),recA(6),sodA(19),tpi(11),mlst_clade(4.0) RT017_M68.fasta,cdifficile,37,adk(3),atpA(7),dxr(3),glyA(8),recA(6),sodA(9),tpi(11),mlst_clade(4.0) RT023_CD305.fasta,cdifficile,791,adk(65),atpA(1),dxr(4),glyA(7),recA(2),sodA(8),tpi(7),mlst_clade(nan) RT027_CD196.fasta,cdifficile,1,adk(1),atpA(1),dxr(1),glyA(10),recA(1),sodA(3),tpi(5),mlst_clade(2.0) RT027_R20291_July2013.fasta,cdifficile,1,adk(1),atpA(1),dxr(1),glyA(10),recA(1),sodA(3),tpi(5),mlst_clade(2.0) RT078_CDM120.fasta,cdifficile,11,adk(5),atpA(8),dxr(5),glyA(11),recA(9),sodA(11),tpi(8),mlst_clade(5.0) RT106_Liv22.fasta,cdifficile,42,adk(1),atpA(1),dxr(2),glyA(1),recA(1),sodA(7),tpi(1),mlst_clade(1.0)

# Usage
FastMLST uses as input a assembly in FASTA format. Optionally it can be compressed with gzip or bzip2.

$ fastmlst cdiff_refferences/RT078_CDM120.fasta RT078_CDM120.fasta,cdifficile,11,adk(5),atpA(8),dxr(5),glyA(11),recA(9),sodA(11),tpi(8),mlst_clade(5.0)

The output is a comma separated file (csv) by default, but it can be modified using the `-s` option.

$ fastmlst -s '\t' cdiff_refferences/RT078_CDM120.fasta RT078_CDM120.fasta cdifficile 11 adk(5) atpA(8) dxr(5) glyA(11) recA(9) sodA(11) tpi(8) mlst_clade(5.0)

There are two options for saving the result in a text file:

$ fastmlst -to mlst.csv cdiff_refferences/RT078_CDM120.fasta $ fastmlst cdiff_refferences/RT078_CDM120.fasta > mlst.csv

Both options generate the `mlst.csv` file containing the FastMLST result.

FastMLST is able to generate a file in FASTA format with the alleles concatenated in the same way as they are in PubMLST. If any genome is not found in this result, it means that (1) Allele contain Ns, (2) alleles missing or (3) contamination (multiple alleles for one genome). Optionally the name could be modified with `-fo` option:

$ fastmlst cdiff_refferences/RT078_CDM120.fasta

FastMLST will  try to use all available cores. It can be modified with `-t` option:

$ fastmlst -t 2 cdiff_refferences/RT078_CDM120.fasta

You also can specify to FastMLST the scheme name using the `--scheme` option, this is particularly useful when there is more than one scheme per species. If you use this option, it will generate a table with a new format (available since version 0.0.10) which is easier to use in other programs like [phyloviz](http://www.phyloviz.net/).

$ fastmlst --scheme cdifficile cdiff_refferences/RT078_CDM120.fasta Genome,Scheme,ST,adk,atpA,dxr,glyA,recA,sodA,tpi,mlst_clade RT078_CDM120.fasta,cdifficile,11,5,8,5,11,9,11,8,5.0


If you want the old format just add the option `--legacy`:

$ fastmlst --legacy --scheme cdifficile cdiff_refferences/RT078_CDM120.fasta RT078_CDM120.fasta,cdifficile,11,adk(5),atpA(8),dxr(5),glyA(11),recA(9),sodA(11),tpi(8),mlst_clade(5.0)


A list of schemes supported is displayed with the option `--scheme-list` in the following format `(n) code_name: Full species name`

**Hint: You must use just the `code_name` in the `--scheme` option.**

$ fastmlst --scheme-list There are 153 schemes (A round of applause to @keithajolley! (Jolley, et al., 2018)):

(1) achromobacter: Achromobacter spp. (2) abaumannii#1: Acinetobacter baumannii#1 (3) abaumannii#2: Acinetobacter baumannii#2 (n) (...) (151) xfastidiosa: Xylella fastidiosa (152) ypseudotuberculosis: Yersinia pseudotuberculosis (153) yruckeri: Yersinia ruckeri


A new option in version v0.0.14 is the possibility to obtain the alleles divided into individual FASTA files (one for each allele in the scheme), ready to be used in other programs such as MLSTest.

$ fastmlst --scheme cdifficile cdiff_refferences/*.fasta --splited-output splited_mlst Genome,Scheme,ST,adk,atpA,dxr,glyA,recA,sodA,tpi,mlst_clade RT001_BI9.fasta,cdifficile,3,1,1,2,1,1,1,1,1.0 RT001_Liv24.fasta,cdifficile,3,1,1,2,1,1,1,1,1.0 RT002_TL178.fasta,cdifficile,8,1,1,2,6,1,5,1,1.0 RT012_CD630_chr_V12.fasta,cdifficile,54,1,4,7,1,1,3,3,1.0 RT014_TL176_v3.fasta,cdifficile,13,1,1,6,1,5,3,1,1.0 RT015_TL174.fasta,cdifficile,44,2,5,2,1,1,3,1,1.0 RT017_CF5.fasta,cdifficile,86,3,7,3,8,6,19,11,4.0 RT017_M68.fasta,cdifficile,37,3,7,3,8,6,9,11,4.0 RT023_CD305.fasta,cdifficile,791,65,1,4,7,2,8,7, RT027_CD196.fasta,cdifficile,1,1,1,1,10,1,3,5,2.0 RT027_R20291_July2013.fasta,cdifficile,1,1,1,1,10,1,3,5,2.0 RT078_CDM120.fasta,cdifficile,11,5,8,5,11,9,11,8,5.0 RT106_Liv22.fasta,cdifficile,42,1,1,2,1,1,7,1,1.0

$ ls splited_mlst/ adk.fasta atpA.fasta dxr.fasta glyA.fasta recA.fasta sodA.fasta tpi.fasta $ cat splited_mlst/adk.fasta

RT001_BI9.fasta adk CATATATCAACAGGAGATATATTCAGAAAGAATATAAAAGAGGGAACAGAACTTGGAAAA AAAGCTAAAGAATACATGGACCAAGGTTTATTAGTACCAGATGAGTTAACTGTAGGTTTA GTTACTGATAGAATATCTCAAGAAGATTGTAAAAATGGATTTATGTTAGATGGATTTCCA AGAAATGTAGCACAAGGAGAACATTTAGATATCTTCTTAAAAAATGCTGGTATATCACTA GATAAAGTTGTCAATATTGAAGTTGATAAGAGTATATTAGTGTCTAGAGCAGTTGGTAGA AGAATATGTAAGTCTTGTGGAGCTACTTACCATGTTGAGTTTAATCCTCCTAAAGTAGAA GGTGTATGTGATGTATGCCAAGGAGAATTATATCAAAGAGCTGATGATAATGAAGAAACT GTATCTAAGAGAATACAAGTTTATCTAGATGAAACTAAGCCTTTAGTAGATTATTATAGC AAACAAGGTATAATAGCAGAT ... RT106_Liv22.fasta adk CATATATCAACAGGAGATATATTCAGAAAGAATATAAAAGAGGGAACAGAACTTGGAAAA AAAGCTAAAGAATACATGGACCAAGGTTTATTAGTACCAGATGAGTTAACTGTAGGTTTA GTTACTGATAGAATATCTCAAGAAGATTGTAAAAATGGATTTATGTTAGATGGATTTCCA AGAAATGTAGCACAAGGAGAACATTTAGATATCTTCTTAAAAAATGCTGGTATATCACTA GATAAAGTTGTCAATATTGAAGTTGATAAGAGTATATTAGTGTCTAGAGCAGTTGGTAGA AGAATATGTAAGTCTTGTGGAGCTACTTACCATGTTGAGTTTAATCCTCCTAAAGTAGAA GGTGTATGTGATGTATGCCAAGGAGAATTATATCAAAGAGCTGATGATAATGAAGAAACT GTATCTAAGAGAATACAAGTTTATCTAGATGAAACTAAGCCTTTAGTAGATTATTATAGC AAACAAGGTATAATAGCAGAT

Output symbology

Symbol	Meaning	Length	Identity
`n`	Exact intact allele	100%	100%
`~n`	Novel full length allele similar to n	100%	≥ `-pid`
`n?`	Partial match to known allele	≥ `-cov`	≥ `-pid`
`-`	Allele missing (or allele containing Ns)	< `-cov`	< `-pid`
`n,m`	Multiple alleles

Scoring system

FastMLST uses a scoring system to determine the scheme to be employed similar to that proposed by Tseemann. The score for a scheme with N alleles is as follows:

+100/N points for an exact allele match e.g. 1
+70/N points for a novel allele match e.g. ~1
+20/N points for a partial allele match e.g. 1?

0 points for a missing allele e.g. -

Updating the Schemes

You should always, always, always keep the PubMLST database updated. Fortunately there is a function to simply update the database:

$ fastmlst --update-mlst

You can indicate how many schemes will be downloaded in parallel with -t option if you want more download speed.

$ fastmlst --update-mlst -t 24

Complete usage Options


usage: fastmlst [-h] [-t THREADS] [-v {0,1,2}] [-s SEPARATOR] [-sch SCHEME] [--scheme-list] [-fo FASTAOUTPUT]
            [-to TABLEOUTPUT] [-cov COVERAGE] [-pid IDENTITY] [--update-mlst] [-sp SPLITED_OUTPUT] [--fasta2line]
            [--longheader] [--legacy] [-n NOVEL] [-V]
            [genomes ...]

positional arguments: genomes

optional arguments: -h, --help show this help message and exit -t THREADS, --threads THREADS Number of threads to use (default 12) -v {0,1,2}, --verbose {0,1,2} Verbose output level choices: [0, 1, 2] -s SEPARATOR, --separator SEPARATOR Choose a character to use as a separator (default ",") -sch SCHEME, --scheme SCHEME Set a scheme target (I am not dumb, let me choose a scheme by myself!) --scheme-list Show all schemes supported -fo FASTAOUTPUT, --fastaoutput FASTAOUTPUT File name of the concatenated alleles output (default "") -to TABLEOUTPUT, --tableoutput TABLEOUTPUT File name of the MLST table output (default STDOUT) -cov COVERAGE, --coverage COVERAGE DNA %Cov to report high quality partial allele [?] (default 99%) -pid IDENTITY, --identity IDENTITY DNA %Identity of full allelle to consider 'similar' [~] (default 95%) --update-mlst Perform an update of the PubMLST database -sp SPLITED_OUTPUT, --splited-output SPLITED_OUTPUT Directory output for splited alleles (default "") --fasta2line The fasta files will be in fasta2line format --longheader If --longheader is invoked, the header of FASTA file contain a long description --legacy If --legacy is invoked, the csv reported contain the gene name and the allele id in the row [adk(1),atpA(4),dxr(7),glyA(1),recA(1),sodA(3),tpi(3)]. This option is only available when the --scheme is defined -n NOVEL, --novel NOVEL File name of the novel alleles -V, --version Show program's version number and exit


# Citation

Guerrero-Araya E, Muñoz M, Rodríguez C, Paredes-Sabja D. FastMLST: A Multi-core Tool for Multilocus Sequence Typing of Draft Genome Assemblies. Bioinform Biol Insights. 2021 Nov 27;15:11779322211059238. doi: [10.1177/11779322211059238](https://doi.org/10.1177/11779322211059238). PMID: 34866905; PMCID: [PMC8637782](http://www.ncbi.nlm.nih.gov/pmc/articles/pmc8637782/).

EnzoAndree / FastMLST

readme