primerdiffer: batch design primers for chromosomal level genotyping

Installation:

The package worked with python version >=3.8 (Tested in python 3.8, 3.9, 3.10 and 3.11). Only tested in linux x64 system.

python package:

primer3-py>=0.6.1
biopython>=1.7.8

other program in your $PATH:

ncbi-blast

example code to install the packages under python3 with pip and conda

pip install primerdiffer # will also install primer3-py and biopython  
conda install -c bioconda blast # install ncbi blast, which is not included in pip installation

Case example: used primerdesign.py to design primers for two haplotypes

Design genome-wide specific primers for two species/sub-species/divergent sequences:

Greedy design primers for a region in genome1 and make a specificity check using genome2

The dis-similarity between genome1 and genome2 >= 5%.


usage: primerdesign.py [-h] [-d WKDIR] [-g1 GENOME1] [-g2 GENOME2] [-pos POSITION] [--alignlen ALIGNLEN]
                   [--free3len FREE3LEN] [--productlen PRODUCTLEN] [-h1 HIT1] [-h2 HIT2]
                   [-i INTERVAL] [-j JUMP] [--prefix PREFIX]

optional arguments: -h, --help show this help message and exit -d WKDIR, --wkdir WKDIR The dir path contain the file, if not given, use the current dir -g1 GENOME1, --genome1 GENOME1 the fasta file used to design primer -g2 GENOME2, --genome2 GENOME2 the fasta file used to check false priming -pos POSITION, --position POSITION position on genome1 to design primer, use string with IGV format, like ChrX:1956230-1976220 --alignlen ALIGNLEN the cutoff of primer min align length as a right hit, default is 16 --free3len FREE3LEN the cutoff of primer 3' align length as a right hit, default is 2 --productlen PRODUCTLEN the cutoff of max product which will be treated as a false priming, default is 2000. -h1 HIT1, --hit1 HIT1 the cutoff of max number of in-silicon PCR product which can be found in genome1. default is 1 -h2 HIT2, --hit2 HIT2 the cutoff of max number of in-silicon PCR product which can be found in genome2, default is 0 -i INTERVAL, --interval INTERVAL interval is the region begins to pick primers, default is 5000. If 5k is the unit, will pick one primer each 5k -j JUMP, --jump JUMP jump is the region to jump inside intervals if the prvious interval can not generate a valid primer, the smaller, more sites to check. Default is 500. --prefix PREFIX prefix of output file, default is primers


Use _C. nigoni_ and _C.briggsae_ genomes as example. The two fasta files can be downloaded separately 
from [cb5.fa](https://github.com/Runsheng/cbgenome/releases/download/cb5pre_cn3pre/cb5.fa.gz) and 
[cn3_new.fa](https://github.com/Runsheng/cbgenome/releases/download/cb5pre_cn3pre/cn3_new.fa.gz). 

The _C. nigoni_ genome is cn3_new.fa and _C. briggsae_ genome is cb5.fa. To design _C. briggsae_ unique primer, 
which would not amplify any region in _C. nigoni_, and amplify only one region in _C. briggsae_. 
The targeted region for C. briggsae is ChrX:12881200-15106660 (-pos or --position),
one primer is designed for every 4kb interval (-i or --interval).
```bash
primerdesign.py -g1 cb5.fa -g2 cn3_new.fa -pos "ChrX:12881200-15106660" --interval 4000

# check the result in file "primers_ChrX_12881200-15106660.txt"
head primers_ChrX_12881200-15106660.txt
#ChrX:12881200-12881700 GATCCAAAACATGAGTGGCC    CGAGATCATTGGCTCAAAGT    287
#ChrX:12886200-12886700 GTTTTCTCTTCAAGTGCCCG    CTCCCACATCTTGTAGGTCC    416
#ChrX:12891200-12891700 GTAGATGCTGTTGAGGCTCT    CGAGTGGGACATTGTCAGTA    299
#ChrX:12896200-12896700 GGCGCATTATACGAAGCTTT    TTCCTGCTGCCAGATAGAAG    362

Case example: use getpos_primers.py to annotate the primerdiffer.py output with position and in silicon PCR result

usage: getpos_primers.py [-h] [-d WKDIR] [-f FILE] [-g GENOME] [--alignlen ALIGNLEN] [--free3len FREE3LEN] [--productlen PRODUCTLEN] [-o OUT]

optional arguments:
  -h, --help            show this help message and exit
  -d WKDIR, --wkdir WKDIR
                        The dir path contain the file, if not given, use the current dir
  -f FILE, --file FILE  the 4 col table generated by primerdesign.py
  -g GENOME, --genome GENOME
                        the fasta file used to design primer
  --alignlen ALIGNLEN   the cutoff of primer min align length as a right hit, default is 16
  --free3len FREE3LEN   the cutoff of primer 3' align length as a right hit, default is 2
  --productlen PRODUCTLEN  the cutoff of max product which will be treated as a false priming, default is 2000.
  -o OUT, --out OUT     output file, contains possible amplification regions of this primer pair

# example:  first check the input file format, the col4 is from the primerdesign.py output
head primers_ChrX_12881200-15106660.txt 
#ChrX:12881200-12881700 GATCCAAAACATGAGTGGCC    CGAGATCATTGGCTCAAAGT    287

# run get_posprimers.py
getpos_primers.py -f primers_ChrX_12881200-15106660.txt -g cb5.fa -o primer_pos.txt

# the output is 6 col table
#ChrX:12881200-12881700 GATCCAAAACATGAGTGGCC    CGAGATCATTGGCTCAAAGT    287 ChrX:12881301-12881587  ATCCAAAACATGAG....

Case example: in silico PCR for one primer

Use in silico PCR to get the position and the product of one primer

usage: ispcr.py [-h] [-d WKDIR] [-f FORWARD] [-r REVERSE] [-g GENOME] [--alignlen ALIGNLEN]
                [--free3len FREE3LEN] [--productlen PRODUCTLEN] [-o OUT]

optional arguments:
  -h, --help            show this help message and exit
  -d WKDIR, --wkdir WKDIR
                        The dir path contain the file, if not given, use the current dir
  -f FORWARD, --forward FORWARD
                        the forward primer sequence
  -r REVERSE, --reverse REVERSE
                        the reverse primer sequence
  -g GENOME, --genome GENOME
                        the fasta file used to design primer
  --alignlen ALIGNLEN   the cutoff of primer min align length as a right hit, default is 16
  --free3len FREE3LEN   the cutoff of primer 3' align length as a right hit, default is 2
  --productlen PRODUCTLEN
                        the cutoff of max product which will be treated as a false priming, default is
                        2000.
  -o OUT, --out OUT     output file, contains all possible amplification regions of this primer pair

ispcr.py -f gcactttcatgtccctcaac -r cactctattctcaccccacc -g cb5.fa -o ispcr.fa

# check the PCR product in ispcr.fa
head ispcr.fa
#>ChrI:230699-231076_RC
#GCACTTTCATGTCCCTCAACCAGTCGTTTTTCCTTACCTCTCCCCTTCCTTTTTTCCCCCTCCCAGATGACGTCACCCATCTGTCC
#ACCCTTCTAACGGTCCCCCCCACCATCTGCATGGTGTCCTCGGGGGTGAACAGCTGCACATTTATTGTTCCCTTCTATTCCCCCCT
#CCTCGGTCATCGCGGTTTTATCCCCGCCGTCCATTTGACCATTCTTTGCGTCTCTTCCCTCTCTCTCTCTCTCTCTCTCTCTCTCT
#CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTCTTTTTCTTCTAGGCGAAAGAGGTCACATGGAAGAGAAGAGGATG
#ATGATGATGATGATGGTGGGGTGAGAATAGAGT

Case example: Design general purpose primers with given parameters

The default primer design parameter is described in general_setting.py:

primer3_general_settings =  {
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_PICK_LEFT_PRIMER':1,
        'PRIMER_PICK_RIGHT_PRIMER':1,
        'PRIMER_PICK_INTERNAL_OLIGO': 0,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_MAX_SIZE': 23,
        'PRIMER_OPT_TM': 57.0,
        'PRIMER_MIN_TM': 46.0,
        'PRIMER_MAX_TM': 63.0,
        'PRIMER_MIN_GC': 20.0,
        'PRIMER_MAX_GC': 80.0,
        'PRIMER_PRODUCT_SIZE_RANGE': [[250, 650]],
        'PRIMER_NUM_RETURN':10,
        'PRIMER_MIN_THREE_PRIME_DISTANCE':10,
        'PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS':0
}

The new parameter can be supplemnted as a file with the terms which need to be changed, for example, create a file with name of config.txt

# content of config.txt
# only changed the product size, the others are the same the default
{'PRIMER_PRODUCT_SIZE_RANGE': [[100, 200]]}

Run primerdesign.py to design a qPCR primer(product size 100-200bp, use the config.txt for primer3config) for C. briggsae mitochondrial DNA sequence NC_009885.1 in any region (use 0:-1 means from the first nucleotide to the last); check the C. briggsae genome cb5.fa for false priming, make sure the hit is 0.

primerdesign.py -g1 NC_009885.fa -g2 cb5.fa -pos "NC_009885.1:0:-1" \
                --interval 1000 --hit1 1 --hit2 0 \
                --primer3config config.txt

Citation:

Please kindly cite our paper in bioinformatics if you find primerdiffer or primervcf useful in your work: Link to publication.

Ren, X., Shao, Y., Zhang, Y., Ni, Y., Bi, Y., & Li, R. (2023). Primerdiffer: a python command line module for large-scale primer design in haplotype genotyping. Bioinformatics, btad188.

Other functions:

To design the primer using VCF file for closely related haplotypes (i.e., strain/individual level differences). Please check primervcf package.
add the primerdffer output table description and ispcr function for the output.

Runsheng / primerdiffer

readme