search

bcgsc / mavis

Merging, Annotation, Validation, and Illustration of Structural variants
http://mavis.bcgsc.ca
GNU General Public License v3.0
72 stars 13 forks source link

clustering producing invalid rearrangement #189

Closed calchoo closed 5 years ago

calchoo commented 5 years ago

MAVIS version: 2.2.4

Python version: 3.6.0

OS: Centos 6

Error

                      loading: /projects/wtss_scratch/mavis/POG/POG669/gd-P01759_gn-P01768_rd-P01763/mavis_v2.2.4/2010/P01759_diseased_genome/cluster/batch-TChGqiE6dfozYTTPbLwGMA-77.tab
Traceback (most recent call last):
  File "/gsc/pipelines/mavis/v2.2.4/venv/bin/mavis", line 11, in <module>
    load_entry_point('mavis==2.2.4', 'console_scripts', 'mavis')()
  File "/gsc/pipelines/mavis/v2.2.4/venv/lib/python3.6/site-packages/mavis-2.2.4-py3.6.egg/mavis/main.py", line 414, in main
    raise err
  File "/gsc/pipelines/mavis/v2.2.4/venv/lib/python3.6/site-packages/mavis-2.2.4-py3.6.egg/mavis/main.py", line 371, in main
    validate_main.main(**args, start_time=start_time)
  File "/gsc/pipelines/mavis/v2.2.4/venv/lib/python3.6/site-packages/mavis-2.2.4-py3.6.egg/mavis/validate/main.py", line 86, in main
    cast={COLUMNS.cluster_id: lambda x: str(uuid()) if not x else x}
  File "/gsc/pipelines/mavis/v2.2.4/venv/lib/python3.6/site-packages/mavis-2.2.4-py3.6.egg/mavis/util.py", line 245, in read_inputs
    **kwargs
  File "/gsc/pipelines/mavis/v2.2.4/venv/lib/python3.6/site-packages/mavis-2.2.4-py3.6.egg/mavis/util.py", line 531, in read_bpp_from_input_file
    raise InvalidRearrangement('could not produce a valid rearrangement', row)
mavis.error.InvalidRearrangement: ('could not produce a valid rearrangement', {'tracking_id': 'manta-MantaDEL:175574:0:0:0:0:0;strelka-8YtWsuCjhNRzCL2GN5pdbd', 'library': 'P01759', 'cluster_id': 'GicQ9HpSNkSQZ7woPVDYo2', 'cluster_size': '2', 'event_type': 'deletion', 'break1_chromosome': '15', 'break1_position_start': 67333604, 'break1_position_end': 67333604, 'break1_orientation': 'L', 'break1_strand': '?', 'break1_seq': None, 'break2_chromosome': '15', 'break2_position_start': 67333605, 'break2_position_end': 67333605, 'break2_orientation': 'R', 'break2_strand': '?', 'break2_seq': None, 'opposing_strands': False, 'stranded': False, 'protocol': 'genome', 'disease_status': 'diseased', 'tools': 'manta;strelka', 'untemplated_seq': None, 'BND_DEPTH': None, 'CIGAR': None, 'CONSENSUS': None, 'EVENT': None, 'Germline': None, 'HOMLEN': None, 'HOMSEQ': None, 'IC': None, 'IHP': None, 'IMPRECISE': None, 'INV3': None, 'INV5': None, 'JUNCTION_QUAL': None, 'JUNCTION_SOMATICSCORE': None, 'LEFT_SVINSSEQ': None, 'MAPQ': None, 'MATEID': None, 'MATE_BND_DEPTH': None, 'NT': None, 'OVERLAP': None, 'PE': None, 'PRECISE': None, 'QSI': None, 'QSI_NT': None, 'Quality': None, 'RC': None, 'RIGHT_SVINSSEQ': None, 'RU': None, 'SGT': None, 'SOMATIC': None, 'SOMATICSCORE': None, 'SR': None, 'SRQ': None, 'SVINSLEN': None, 'SVINSSEQ': None, 'SVLEN': None, 'SVMETHOD': None, 'Somatic': None, 'TQSI': None, 'TQSI_NT': None, 'id': None, 'line_no': 365, 'tag': None, 'transabyss_gene': None, 'transabyss_genes': None})

original inputs

Manta
15  67333523    MantaDEL:175574:0:0:0:0:0   GGAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGGAAAAGGGAAGGGAAGGTAGA G   89  MinGQ   END=67333581;SVTYPE=DEL;SVLEN=-58;CIGAR=1M58D;CIPOS=0,96;HOMLEN=96;HOMSEQ=GAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGG  GT:FT:GQ:PL:PR:SR   0/1:MinGQ:3:139,3,0:0,0:0,4

Strelka
15  67333623    .   AGG A   .   QSI_ref IC=1;IHP=4;NT=ref;QSI=12;QSI_NT=12;RC=3;RU=G;SGT=ref->het;SOMATIC;TQSI=2;TQSI_NT=2  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   17:17:18,18:0,0:0,0:22.68:0.03:0.00 40:40:28,30:6,6:8,8:41.77:3.90:0.00

converted inputs

manta-MantaDEL:175574:0:0:0:0:0 deletion    15  67333523    67333619    L   ?   None    15  67333581    67333581    R   ?   None    False   False   manta       None    1M58D   None    96  GAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGGAAAAGGGAAGGGAAGGTAGAGAAGGAAGG    None    None    None    None    None    None    None    None    None    None    None    None    None    -58 MantaDEL:175574:0:0:0:0:0
strelka-8YtWsuCjhNRzCL2GN5pdbd  deletion    15  67333623    67333623    L   ?   None    15  67333625    67333625    R   ?   None    False   False   strelka     1   4   ref None    12  12  3   G   ref->het    True    2   2

Clustering output

manta-MantaDEL:175574:0:0:0:0:0;strelka-8YtWsuCjhNRzCL2GN5pdbd      sDpE4no2SeREAdspcg4zZU  2   deletion    15  67333604    67333604    L   ?   None    15  67333605    67333605    R   ?   None    False   False   genome  normal  manta;strelka   None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None    None
creisle commented 5 years ago

related PR https://github.com/bcgsc/mavis/pull/194