IronThrone-GoT script
, Combine_IronThrone_Parallel_Output.R
script, and the appropriate Parallelized UMI Collapse scriptR1
or R2
B/barcode
.config
Option | Description |
---|---|
-tl/--target_lines |
desired file length for split fastq files (must be multiple of 4, default: 500000) |
-pcr/--pcr_read_threshold |
ratio above which majority of PCR reads must be in order for a UMI to be called definitively (default: 0.5) |
-z/--skip_shuf |
if set to 1, skip the random shuffling of fastq files step, useful if needing to re-run just the IronThrone and UMI collapsing components of the pipeline (default: 0) |
-x/--skip_iron_throne |
if set to 1, skip the IronThrone step of the pipeline, useful if run in combination with skip_shuf to only run the UMI collapsing component of the pipeline (default: 0) |
-ld/--levenshtein_distance |
Allowed Levenshtein distance between UMIs determined to be similar enough for collapsing (default: 0.1) |
R1
and 1 R2
file.txt
file of barcodes from a corresponding 10X run. Note: If using the unzipped barcodes.tsv
file from CellRanger's filtered_feature_bc_matrix
folder, barcodes will often be appended with -1
, which will result in an error. You can run sed 's/..$//' < barcodes.tsv > barcodes_trim.tsv
to trim these suffixes..config
file entries should be hard-tab-separatedProcesses GoT amplicon data and generates a table of metrics
(created by the Landau lab at the New York Genome Center)
IronThrone-GoT
supports both uncompressed and GZipped formats.
To scan the expected sequences at specific positions in amplicon reads,\ .config file should be prepared as follows:
(linear_example.config)
GCAGCAGAGAAACAAATGAAGGA 1 23 #(1st row) primer.sequence start.pos end.pos
AAACAGGACGAGGAGCAGAGG 25 45 #(2nd row) shared.sequence start.pos end.pos
AAGAAGACAAG 59 69 #(3rd row) WT.sequence start.pos end.pos
TGAGGACAAAG 59 69 #(4th row) MUT.sequence start.pos end.pos
(circ_example.config)
GAAGAAGACAAGAAACGCAAAGAGG 1 25 #(1st row) primer.sequence start.pos end.pos
AGGAGGAGGCAGAGGACAA 26 44 #(2nd row) shared.sequence start.pos end.pos
GGAGGATGATG 45 55 #(3rd row) WT.sequence start.pos end.pos
TTGTCGGAGGA 45 55 #(4th row) MUT.sequence start.pos end.pos
TGAGGATGAGGAGGATGAGG 66 85 #(5th row) PCR#2Fw_in_WT.sequence start.pos end.pos
TGAGGATGAGGAGGATGAGG 71 90 #(6th row) PCR#2Fw_in_MUT.sequence start.pos end.pos
CACTGAGAATGTAAGAACTACAAACAA 96 122 #(7th row) PCR#2Rv_in_WT.sequence start.pos end.pos
CACTGAGAATGTAAGAACTACAAACAA 101 127 #(8th row) PCR#2Fv_in_MUT.sequence start.pos end.pos
A config file should be prepared in tab-separated format. As an example, see
testdata/linear_example.config
ortestdata/circ_example.config
.
This file provides a list of barcodes that are put in preparation for both GoT and 10X libraries, so that false barcodes are distinguished.
Whitelisted barcode files provided by 10X are collected at barcodes10X/
directory.
Choose the whitelist barcode file considering which 10X chemistry version used:
737K-august-2016.txt
(default)3M-february-2018.txt
Download the
3M-february-2018.txt
file here, and save atbarcodes10X/
directory.
Also, the length of UMI depends on 10X chemistry version so set --umilen
if needed.
10
(default)12
IronThrone-GoT [options] --run linear --fastqR1 <in.R1.fastq> --fastqR2 <in.R2.fastq>
--config <in.config> --sample <out.prefix> --outdir <out.path>
Option | Description |
---|---|
-r/--run |
run module for processing linear or circ GoT (default: linear ) |
-f1/--fastqR1 |
input R1.FASTQ FILE (input file can be in GZip format with .gz extension) |
-f2/--fastqR2 |
input R2.FASTQ FILE (input file can be in GZip format with .gz extension) |
-c/--config |
input CONFIG FILE (input file should be in tab-separated) |
Option | Description |
---|---|
-m/--mmtch |
allowed mismatch ratio to grep the expected sequences (default: 0.2) |
-p/--postP |
cutoff for the posterior probability in the barcode replacement (default: 0.99) |
-d/--dupcut |
cutoff for the total number of duplication (default: 1) |
-b/--bclen |
length of barcode (default: 16) |
-u/--umilen |
length of UMI (default: 10) |
-w/--whitelist |
file for whitelisted barcodes (737K-august-2016.txt) |
-s/--sample |
prefix for outputs (myGoT) |
-o/--outdir |
path for outputs (./out) |
-l/--log |
logfile name (myGoT.log) |
-t/--thread |
number of threads to run in parallel (default: 4) |
-k/--keepouts |
if set to 1, keeping intermediate files (default: 0) |
-v/--verbose |
if set to 1, returning more logs (default: 0) |
-h/--help |
show option parameters |
(prefix).summTable.txt is a table of aggregated (semi-colon separated) and averaged metrics sorted by unique cell barcode and UMI.
Column | Description |
---|---|
BC | barcode |
whitelist | Y:barcode was perfectly matched with the whitelisted barcodes N:barcode was not perfectly matched with the whitelisted barcodes, and replaced with statistical significance |
UMI | UMIs sharing the same barcode |
num.WT.in.dups | counts of WT calls for each duplicate read (barcode + each UMI) |
num.MUT.in.dups | counts of MUT calls for each duplicate read (barcode + each UMI) |
num.amb.in.dups | counts of amb calls for each duplicate read (barcode + each UMI) |
call.in.dups | calls for each duplicate read (barcode + each UMI) |
avg.base_error.R2 | average of base errors for entire R2.fastq reads sharing the same barcode |
avg.base_error.primer | average of base errors for the primer region in R2.fastq reads sharing the same barcode |
avg.base_error.shared | average of base errors for the shared region in R2.fastq reads sharing the same barcode |
avg.base_error.WT | average of base errors for the WT region in R2.fastq reads sharing the same barcode |
avg.base_error.MUT | average of base errors for the MUT region in R2.fastq reads sharing the same barcode |
mismatch.primer | counts of mismatches in the primer region for each duplicate read (barcode + each UMI) |
mismatch.shared | counts of mismatches in the shared region for each duplicate read (barcode + each UMI) |
mismatch.WT | counts of mismatches in the WT region for each duplicate read (barcode + each UMI) |
mismatch.MUT | counts of mismatches in the MUT region for each duplicate read (barcode + each UMI) |
WT.calls | counts of total WT call |
MUT.calls | counts of total MUT call |
amb.calls | counts of total amb call |
Test with example .fastq and .config files at testdata/
directory.
(linear-GoT)
IronThrone-GoT --run linear --config linear_example.config \
--fastqR1 linear_example.R1.fastq --fastqR2 linear_example.R2.fastq \
--outdir game --log of --sample throne
(circ-GoT)
IronThrone-GoT --run circ --config circ_example.config \
--fastqR1 circ_example.R1.fastq --fastqR2 circ_example.R2.fastq \
--outdir game --log of --sample throne