search

gtDMMB / RNAStructViz

Visualization, comparison, and analysis of RNA secondary structures via a cross-platform GUI
https://github.com/gtDMMB/RNAStructViz/wiki
GNU General Public License v3.0
17 stars 5 forks source link

Take input in (i,j,k) notation #41

Closed ceheitsch closed 5 years ago

ceheitsch commented 5 years ago

To my knowledge, program does not currently take input in the form of (i,j,k) triples which is generated by some Boltzmann sampling code. For example: Structure 1 -60.60 0.15301E-02 2 152 9 12 80 3 16 30 4 34 74 3 38 70 2 41 67 6 48 59 4 90 121 5 97 114 3 102 109 2 124 136 3 128 132 1

maxieds commented 5 years ago

@ceheitsch The helix data alone is insufficient to load the sequence in RNAStructViz. We need a hybrid of the CT / Dot-Bracket file format data that also happens to include the helices as supplementary data (since we do not currently use these in the application directly). As requested, the documentation for the new format which should be supported shortly (ideally later on today) can be found on this new WIKI page.

maxieds commented 5 years ago

For reference, I basically copied the pairing data / helix notation lines of these files verbatim from the output of GTBoltzmann on the profiling webapp production webpage, and used the same conventions as in Dot-Bracket files for the first two lines with a comment line followed by the string of bases. For example: 

> Sequence file comment goes here
CAAAAGCACCAGGGGUGCUUGAACCAGGAUAGCCUGCGAAAAGGCGGGCUAUCCGGGACCAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUGCAGUUUUUUUUUU
.....((((((((((((((((..((.(((((((((((......))))))))))).))..)))))..)......)))).))..((((..((((......))))..))))....))))............    -49.4   6 116 4, 10 80 2, 12 77 4, 16 67 1, 17 64 5, 24 57 2, 27 54 11, 83 108 4, 89 102 4, 
.....(((((((((..(((((..((.(((((((((((......))))))))))).))..))))).........)))).....((((..((((......))))..))))..).))))............    -52.9   6 116 4, 10 111 1, 11 77 4, 17 64 5, 24 57 2, 27 54 11, 83 108 4, 89 102 4, 
.....((((((((((.(((((..((.(((((((((((......))))))))))).))..))))).((.....))))))))..((((..((((......))))..))))....))))............    -53.9   6 116 4, 10 80 6, 17 64 5, 24 57 2, 27 54 11, 66 74 2, 83 108 4, 89 102 4, 
.....(((((.(((..(((((..((.(((((((((((......))))))))))).))..)))))(......).)))......((((..((((......))))..))))..).))))............    -50.8   6 116 4, 10 111 1, 12 76 3, 17 64 5, 24 57 2, 27 54 11, 65 72 1, 83 108 4, 89 102 4, 
.....((((((((((.(((((..((.(((((((((((......))))))))))).))..))))).((.....))))))))..((((..((((......))))..))))....))))............    -53.9   6 116 4, 10 80 6, 17 64 5, 24 57 2, 27 54 11, 66 74 2, 83 108 4, 89 102 4, 
.....((((((((((....((..((.(((((((((((......))))))))))).))..))((((.....))))))))))..((((..((((......))))..))))....))))............    -52.2   6 116 4, 10 80 6, 20 61 2, 24 57 2, 27 54 11, 62 74 4, 83 108 4, 89 102 4, 
.....((((((((((((((((..((.(((((((((((......)))))))))))))...))))).......)))))).....((((..((((......))))..))))..).))))............    -51.9   6 116 4, 10 111 1, 11 77 6, 17 64 5, 24 56 2, 27 54 11, 83 108 4, 89 102 4, 
...((((((((((((.(((((..((.(((((((((((......))))))))))).))..)))))........))))).....((((..((((......))))..))))..).))))..))........    -48.8   4 120 2, 6 116 4, 10 111 1, 11 77 5, 17 64 5, 24 57 2, 27 54 11, 83 108 4, 89 102 4,
maxieds commented 5 years ago

@ceheitsch As of the latest commit, this feature is implemented. A Homebrew package for Mac OSX is soon to follow.