search

mhalushka / miRge3.0

Comprehensive analysis of small RNA sequencing data
MIT License
28 stars 11 forks source link

mirge3 gets killed #101

Open lchall08 opened 4 hours ago

lchall08 commented 4 hours ago

Running mirge3 on Rat samples: Goes through all the steps until novel miRNAs prediction and throws this error and stops.

Traceback (most recent call last): File "/opt/conda/envs/mirge3/bin/miRge3.0", line 10, in sys.exit(main()) ^^^^^^ File "/opt/conda/envs/mirge3/lib/python3.12/site-packages/mirge/main.py", line 203, in main predict_nmir(args, workDir, ref_db, base_names, pdUnmapped) File "/opt/conda/envs/mirge3/lib/python3.12/site-packages/mirge/libs/novel_mir.py", line 424, in predict_nmir generate_featureFiles(str(Path(outputdir2)), files, chrSeqDic, chrSeqLenDic, miRNAchrCoordivateDic, exactmiRNASeqDic) File "/opt/conda/envs/mirge3/lib/python3.12/site-packages/mirge/libs/generate_featureFiles.py", line 226, in generate_featureFiles features = clusterInstance.calculateFeature() ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ File "/opt/conda/envs/mirge3/lib/python3.12/site-packages/mirge/classes/readCluster.py", line 320, in calculateFeature neclueotideCountList = neclueotideCountList + [templateNucleotide, count_TemplateNucleotide_percentage, count_nonTemplateNucleotide_percentage, count_A_percentage, count_T_percentage, count_C_percentage, count_G_percentage] ^^^^^^^^^^^^^^^^^^ UnboundLocalError: cannot access local variable 'count_A_percentage' where it is not associated with a value

arunhpatil commented 4 hours ago

Hi @lchall08,

I checked the error and it is wierd since count_A_percentage is pre-assigned.

  1. Can you check (the output) if the annotations and summary of miRNA reads are yielding abundant miRNAs, without (or prior to) Novel miRNA predictions.
  2. If adapters are not a problem in the previous step then I like to check the bug with your dataset. Can you share the file or subset which was used here? (Also, it would give more clarity if you could share the command used along with parameters, and you can rename your sample names if you choose).

Thank you, Arun

lchall08 commented 3 hours ago

annotation.report.csv

See attached the annotation report. This error is relatively new. I was previously able to run it successfully with a mouse dataset and this one is Rat so originally I thought it may be a bug in the library but nothing I can tell.

The code I used is: miRge3.0 -s input.txt -db miRBase -lib /research/miRge3_Lib -on rat -cpu 50 -tcf -bam -o output -dex -mdt 1432_samplesheet_1.csv -a TGGAATTCTCGGGTGCCAAGG -NX -nmir

input.txt is just a list of all the fastqs