Issue with Trimmed Reads in Canine miRNA Analysis using miRge3.0

[TomokiMotegi]

Hello,

Thank you for developing miRge! I am trying to analyze canine miRNA using miRge3.0. I was able to successfully create custom canine references using miRge-build and ran our data through the pipeline. However, the results seem to show fewer trimmed reads than expected.

Our library was prepared using the QIAseq miRNA library kit, and we used the standard adapter sequence (AGATCGGAAGAGCACACGTCT).

If there are any mistakes in my code or setup, I would appreciate it if you could kindly point them out.

My result

Code

miRge3.0 \
 -s ./Fastq/47-HSA-1_6816_Dog19-28_mix_S6_L001_R1_001.fastq.gz \
 -db miRGeneDB \
 -lib ./miRge3/test/ \
 -on cfa3 \
 -a AACTGTAGGCACCATCAAT \
 --qiagenumi -umi 0,12 -o test_dir -cpu 10 -udd

Thank you for your support!

Best regards, Tomoki

[arunhpatil]

Hi @TomokiMotegi,

I am glad the mirge-build worked out for you.

Regarding the trimmed reads: I think that this is due to much shorter reads after trimming, we discard all reads that are less than 16 nucleotides in length by default. Also, you are removing PCR duplicates that could also reduce the number of trimmed reads overall. The Unique miRNAs however looks Ok to me.

Let me know your thoughts.

Edited: If you could send a sample file, I can have a look.

Thank you, Arun.

[TomokiMotegi]

Hi Arun,

Thank you so much for your help! I reviewed the "annotation report" on SourceForge, which shows that the data retains around 74%, making me suspect there may be an issue with my analysis.

I’ve shared my data and the original library at the link below: Google Drive Link I apologize for any inconvenience, but I would really appreciate it if you could take a look.

Best regards, Tomoki