--get-seq should be fasta fasta

mmagnus / rna-tools

🔧rna-tools: a toolbox to analyze sequences, structures and simulations of RNA (and more) used by RNA CASP, RNA PUZZLES, and me ;-) docs @ http://rna-tools.rtfd.io web @ http://rna-tools.online

http://rna-tools.online

GNU General Public License v3.0

152 stars 43 forks source link

--get-seq should be fasta fasta #136

Open mmagnus opened 1 year ago

mmagnus commented 1 year ago

(base) ➜  R1117 git:(master) ✗ rna_pdb_tools.py --get-seq R1117TS470_4.pdb
# R1117TS470_4
>0:1-30
UUGGGUUCCCUCACCCCAAUCAUAAAAAGG