DNA shape-based classifier for regulatory elements (R pkg)
The regshape R package (written by Jichen Yang and Stephen Ramsey) provides a classifier for predicting whether a given oligonucleotide sequence (of length l bp, where l would typically vary from six to as high as 25 bp) is, or is not, a transcription factor (TF) binding site. The regshape classifier was developed using data from 75 vertebrate TFs, and thus is not specialized to any particular TF; regshape is a TF-generic classifier for vertebrate regulatory elements based on local three-dimensional shape properties of the DNA as can be discerned from the nucleotide sequence. The regshape package uses the Random Forest classifier (provided by the randomForest R package, which is a required dependency) and it was constructed by analyzing a compendium of representative TF binding site sequences from the JASPAR database (release 5.0) and on a large representative sample of human noncoding DNA sequence from which known TF binding sites (from ENCODE ChIP-seq genome location datasets from 457 different experiments comprising 119 different TFs). The regshape package also incorporates and is built on a model of DNA sequence-dependent shape parameters, called DNAshape, that was developed by Remo Rohs and colleagues at USC (Zhou et al., Nucl Acids Res., v41 Web Server Issue, 2013 (DOI). The regshape package is available on GitHub at the URL github.com/ramseylab/regshape. The regshape package is furnished under the GNU General Public License version 2.0 (see LICENSE file in the package distribution). There are two ways to use the regshape package; processing a vector of short sequences (each of length l), or processing a single long sequence using a sliding window of length l.
To install regshape, the devtools R package can be used.
library(devtools)
install_github("ramseylab/regshape")To use regshape, the package library must first be loaded into your R session:
library(regshape)Once the regshape package has been loaded, you are ready to compute shape scores for a vector of short DNA sequences (in this example, l=6 but any value greater than six is allowed):
getShapeScores(c("AAAAAA","GATACG","TCGAGT"))In many situations, it is convenient to obtain shape scores for short length-l subsequences of a long DNA sequence. For this example, we will use l=8:
getShapeScoresSlidingWindow("AGACACGACGTCGATCATAAACTAGATCAGCCTGA", 8)