search

uzh-dqbm-cmi / PRIDICT

Prime editing guide RNA prediction
https://pridict.it/
MIT License
7 stars 5 forks source link

Error running test case after conda install - tensorflow libflatbuffers.so.2 #8

Closed LHentges closed 1 year ago

LHentges commented 1 year ago

Installation using a fresh conda env, using the pridict_linux.yml, on Ubuntu cluster

python pridict_pegRNA_design.py manual --sequence-name seq1 --sequence 'GCCTGGAGGTGTCTGGGTCCCTCCCCCACCCGACTACTTCACTCTCTGTCCTCTCTGCCCAGGAGCCCAGGATGTGCGAGTTCAAGTGGCTACGGCCGA(G/C)GTGCGAGGCCAGCTCGGGGGCACCGTGGAGCTGCCGTGCCACCTGCTGCCACCTGTTCCTGGACTGTACATCTCCCTGGTGACCTGGCAGCGCCCAGATGCACCTGCGAACCACCAGAATGTGGCCGC'

File ".../lib/python3.10/site-packages/tensorflow/python/pywrap_tensorflow.py", line 62, in from tensorflow.python._pywrap_tensorflow_internal import ImportError: libflatbuffers.so.2: cannot open shared object file: No such file or directory from tensorflow.python._pywrap_tensorflow_internal import

LHentges commented 1 year ago

Tensorflow recommended install is via pip, moved tensorflow-cpu==2.10.0 into pip section

Creates a new error:

ModuleNotFoundError: No module named 'mkl'

LHentges commented 1 year ago

Added mkl-service to conda dependencies.

Creates a new error:

-- Exception occured -- can't convert np.ndarray of type numpy.object_. The only supported types are: float64, float32, float16, complex64, complex128, int64, int32, int16, int8, uint8, and bool. <<< joined row computation process

I think this has to do with pandas 2.0.X

LHentges commented 1 year ago

Fixed! Placed an upper bound of <2 for pandas.

Working version forked here: PRIDICT_conda_yml_fix.

Sent pull request to merge changes with main branch