-
Following the GUIDELINES, the next step is the "Metadata alignment"
![image](https://user-images.githubusercontent.com/43709607/55178810-68f70f00-5186-11e9-8293-5ba7048a2bae.png)
Last year they did …
-
Examples are now provided for this, however this concept still appears to be unclear to some. This issue remains open pending a round of feedback based on improvements to examples and definition.
O…
-
There are differences in the approach between eForms and Ontology, Due to the complexity these differences, the mapping gets complex. Difi propose that the Publication Office takes the responsibility …
-
See also issue #259 and #262
It is now clear to me that trying to use JSON-LD globally to map an arbitrary JSON to an arbitrary ontology is really challenging. I believe we should define a custom a…
-
OBO file available [here](http://purl.obolibrary.org/obo/to.obo)
-
A formal alignment of the TD model with SOSA/SSN should be provided to (1) keep a certain coherence between the work of all W3C groups and (2) to facilitate the semantic annotation of TDs, since most …
-
in setup.py the README and ingest.py and requirements.txt:
```
$ grep -r ga4gh
requirements.txt:ga4gh-server
README.rst:Requires [ga4gh-server](https://github.com/ga4gh/ga4gh-server),
README.r…
-
The TD spec states in [Section 5.3.2 Property](https://w3c.github.io/wot-thing-description/#property) that
> Property instances are also instances of the class DataSchema.
Looking at the [Inf…
-
https://www.ncbi.nlm.nih.gov/pubmed/?term=Three+Novel+Mutations+in+the+NPHS1+Gene+in+Vietnamese+Patients+with+Congenital+Nephrotic+Syndrome
-
Hi,
This is somewhat similar to #2070. We have sing end .fastq files with the following format:
@NB500965:105:HC5J5BGX2:1:11108:16467:3587 1:N:0:**ATCACG**
TTCAAGTAATCCAGGATAGG**AACTGTAGGCACCAT…