-
We are starting to look at paired sequencing data and I am starting to wonder how one determines uniqueness of a pair of sequences. This is related to #246 but I thought it worthy of a separate discus…
-
This simple RegEx pattern will allow for spellchecking every single English word.
Nebula should loop through every word on every pageload and verify each word is spelled correctly. Also on the admi…
-
James Overton @jamesaoverton discovered a number of logical errors in the CL related to conflicting has_plasma_membrane_part and lack_plasma_membrane_part relations in terms in class-subclass relation…
-
[Term]
id: CL:0002489
name: double negative thymocyte
namespace: cell
def: "A thymocyte that lacks expression of CD4 and CD8." [GOC:tfm, MP:0002407]
***synonym: "double negative T cell" BROAD []
is_a:…
-
### Issue description
*Making an api call to the Search endpoint using a `matchType` of "Contains" for `query` "M200" returns wrong results*
> **ESTIMATE** 20
### Steps to reproduce the issue
…
-
Similar to what we have done with the OT-I for @pinarden's paper, we need this TCR in house for better positive/negative control against LLC (see #3).
```
>pmel_TCRA
ATGATGAAATCCTTGAGTGTTTCACTAGT…
-
**Submitting author:** @TomKellyGenetics (S. Thomas Kelly)
**Repository:** https://github.com/TomKellyGenetics/graphsim
**Version:** v1.0.0-joss
**Editor:** @majensen
**Reviewer:** @rcannood, @corybru…
-
Notes:
> I figured out how to export gated populations as .fcs files. As a test case I exported the raw data for CD4+ T cells from our best run. It includes each gated population stained with the…
-
Any reason why this is not under "system process"?
-
Hi @leonardiwagner, i'm still working on the accomplishments however the behaviour of the deployment of its subsections seems to be quite different from other sections. Actually that's what I'm able t…