-
https://mp.weixin.qq.com/s/vXEMXTr2OFaUWWpgNH1d_w
ixxmu updated
2 years ago
-
I am afraid the MAFFT benchmark performed in the [LinearTurboFold](https://www.biorxiv.org/content/10.1101/2020.11.23.393488v2.full) is not completely fair. MAFFT not only has pure sequence alignment …
-
Salis lab has previously made a ribosomal binding site calculator, which can predict translation initiation rates from proteins.
However, it is slow (requiring a queue on a website) and closed sour…
-
I'm observing a discrepancy in the dg given by calcHairpin for 'TTAACCTCAGATCCTAAGCCGCACAAAGTTGCGGCTTAGGATCTGA', a sequence from a paper I am reading.
-
OK, Biolink 2.0 (6/1 release date) has various changes that will affect KG2:
- `GenomicEntity` becomes a mixin
- `NucleicAcidEntity` groups DNA, RNA, etc.
- `ChemicalSubstance` -> `SmallMolecule`…
-
When using the code from https://github.com/rwth-i6/returnn_common/blob/main/models/transducer/recomb_recog.py inside of a transducer experiment (e.g. https://github.com/rwth-i6/returnn-experiments/bl…
-
Please provide as much information as you can:
* **GO term ID and Label**
GO:0097617 annealing activity
* **Reason for merge**
This does not represent a normal function - and no different fro…