-
**_The options for inclusion of the CRISPR data from OTAR015 currently are:_**
1. Create a new datatype.
2. Add it as a new data source to an existing data type.
3. Add it to Affected Pathways whic…
-
-
This SEP proposes a systematic set of "stem-top" glyphs representing small sites affecting DNA, RNA, or protein. The glyphs in this system are Biopolymer Location, Stability Element, and Cleavage Sit…
-
the current version of crispor seems to calculates the guide cfd score but doesn't print it to the output. Instead only the MIT specificity score and number of off-targets is printed. Would you be abl…
genya updated
5 years ago
-
Hi there, I'm posting to ask for help with errors encountered trying to run CRISPOR locally. Please let me know if you have any ideas how to troubleshoot this. Any help would be greatly appreciated!
…
genya updated
5 years ago
-
Linking experimental data with SBOL designs is becoming critical to a number of important projects. Therefore this SEP introduces a Design-Build-Test data model for SBOL. [SEP 14 is here.](https://git…
-
Linking experimental data to samples and genetic designs is becoming critical to many synthetic biology projects.
We thus propose to add two new classes, Experiment and ExperimentalData, to enable …
-
-
Hi, I am having an issue with the readToTargets function in which my metadata columns (name and score) seem to disappear in the crispr_set that is created even though they are read in correctly into a…
-
The input file is supposed to be like this:
row1: GENE_CLONE GENE Sample1 Sample2
row2: A1BG_CACCTTCGAGCTGCTGCGCG A1BG 94 713
But screens data are now analyzed with TKOv2 that contains the genom…