-
I'm observing a discrepancy in the dg given by calcHairpin for 'TTAACCTCAGATCCTAAGCCGCACAAAGTTGCGGCTTAGGATCTGA', a sequence from a paper I am reading.
![image](https://user-images.githubusercontent…
-
```
ubuntu@ip-172-31-0-216:~/rna-tools/opt/QRNAS$ make
g++ --std=c++03 -Wall -O3 -Iinclude -DSEQUENTIAL -o QRNA bprestr.cpp main.cpp tatom.cpp tbond.cpp tdihed.cpp textutils.cpp timpro.cpp tmolecule…
-
I tried to change the text color of the `Text` objects representing the bases in `plot_nucleotide_secondary_structure()`, but I found no appropriate parameter for it. I think this would be a nice opti…
-
In `energy_of_ml_pt`, `i` is the nucleotide at the 5-prime end and `j` is the nucleotide at the 3-prime end of the closing base pair of the multi-loop.
When setting the mismatching nucleotide at t…
-
We need to double-check the methods section, including disambiguating the various labware, "deepwell" or not.
@daneckaw has agreed to do this by next week (11th June). Then we should kick back over…
-
Update the following URL to point to the GitHub repository of
the package you wish to submit to _Bioconductor_
- Repository: https://github.com/YuLab-SMU/ggmsa
Confirm the following by editing …
-
Hi, I have a question regarding a warning message I've been getting from running `RNAfold`.
Sometimes I get a message like
```
WARNING: ...from traverse_loop. Loop 3 has crossed regions
```
…
-
**What is this request referring to?**
i) 2S ribosomal RNA gene
ii) 2S ribosomal RNA
**What is the name you would like SO to give the term?**
The name of the term SO can use. Note, if you incl…
sjm41 updated
3 years ago
-
Issue to discuss integration of a protein viewer into the Cell Atlas.
-
**Introduction of yourself:**
We are three developers involved in this proposal:
Lluís Revilla Sancho, a PhD student interested in gene sets and how to store and analyse cell signatures, pathways …