-
name: Small non-coding RNA
term: sncRNA
definition: A non-coding RNA
-
I think this is happening because there are no reverse strand mitochondrial chromosome features in Chado.
![mito-fail-1](https://user-images.githubusercontent.com/90474/40584039-574ef5c0-61ee-11e8-…
-
After the updates to manage the FASTA files with lines of max 80 characters, the input is now processed in "blocks":
- header
- blocks of contiguous valid RNAs
- blocks of contiguous valid structur…
-
Update the following URL to point to the GitHub repository of
the package you wish to submit to _Bioconductor_
- Repository: https://github.com/LaraSellesVidal/ncRNAtools
Confirm the following …
-
Aligning pacbio reads to flu references.
@jbloom when I'm aligning the reads there seems to be some issue in my annotation because `[most reads end up not aligning](notebooks/align_pacbio.py.ipynb)…
-
Hi, How is this scenario possible:
from Vienna package docs:
```
$ RNAsubopt -e 1 -s < test.seq
CUACGGCGCGGCGCCCUUGGCGA -500 100
...........((((...)))). -5.00
....((((...))))........ -4…
-
seem empty result output by htseq-count step
-
In GitLab by @vioannid on Jul 14, 2015, 17:17
Prepare an end-to-end workflow as described below:
- input file with 20 gene ids of the same species
- submit to the server (use only default parameter…
-
**Recruitment open and in full swing by**: Dec. 10th 2019
- Aim for 2-3 industry-led teams. Recruitment for bioinformatics.
- [x] Prepare email advertisment for email-lists (including RNA Society …
-
Update the following URL to point to the GitHub repository of
the package you wish to submit to _Bioconductor_
- Repository: https://github.com/LaraSellesVidal/rfaRm
Confirm the following by ed…