-
Hi,
I have an alignment file generated from snippy. Now I am using IQ-Tree with 480 sequences for constructing phylogenetic tree. I ran IQ-tree with the following command. However, it is taking so lo…
-
Hi Jim
PrimerTree is a very handy tool! Recently when I ran the package, I got this error. I attached the output here. Do you know if it's because there's too many blast hits?
> Primer = search_prime…
-
Hi, jeffdaily, thanks for your great work!
Let's start with an exmple. When I do a global alignment for these two sequences:
```
seq1: CAGGACGAGGAGCAGAGGACAAGGAGGAT
seq2: CAGGACGAGGAGCAGAGGCTTAAG…
-
Hi,
I am working on the extraction of mitochondrial genes (mainly for COI) from UCE data. both two fq
file are 3.7 GB, i use the conmmand as follows:
MitoGeneExtractor-v1.9.5 -q AS_aura_YN_1.fq …
-
We were aligning a paired-end sequenced ancient DNA sample, where the reads were merged when they appear to overlap in order to reduce the sequencing error rate and improve alignment accuracy in the f…
-
New error when running taxonomy
**Command:**
cd $tmp
in_dir=/projects/cmi_proj/blood_microbiome/niaid/combined
out_root=$in_dir/shogun
align_dir=$out_root/wol_alignments
taxonomy=/projects/c…
-
What would be the command line parameters for `parasail_aligner` for doing local pairwise alignment (without gaps within the sequences) of two DNA sequences
For example, `1.fa` is like this
```
…
-
### Ask away!
I'm using this workflow on our HPC via Singularity. The input bam is a Promethion run mini bams merged via samtools merge into a single bam (140GB). Is this a missing header issue or a …
-
## Bug Report
### Affected tool(s)
_picard ValidateSameFile_
### Affected version(s)
- [x] Latest public release version [3.1.1]
- [ ] Latest development/master branch (not tested)
### Des…
-
### Contribution guidelines
- [X] I've read the [contribution guidelines](https://github.com/squidfunk/mkdocs-material/blob/master/CONTRIBUTING.md) and wholeheartedly agree
### I've found a bug and …