-
MIGRATED FROM GATK3
@ldgauthier commented on [Thu Mar 12 2015](https://github.com/broadinstitute/gsa-unstable/issues/868)
From Grace Tiao:
We found a large number of PASS frameshift indels th…
-
It would be very helpfull if we could switch gpio's when transmitting so we could switch different outputs for different low pass filters !
the gpio must be part of the command line:
example:
…
-
Is anyone experiencing a clicking or popping sound at the beginning and end of sample playback? Even with the pretty straightforward PlayWAVFromPROGMEM example sketch I get a distinct clicking at the …
-
It would be useful to be able to filter the derivative term of the PID. I suggest a simple moving average, since it can be implemented very efficiently.
-
Point of interest which are showing are not fixed. They change their positions.
Please, refer this link how the points are fixed in iOS from below link.
https://github.com/ProjectDent/ARKit-CoreLo…
-
Hi, I have been experiencing some memory problems when using some of the transforms on the GPU. When I apply the low or high pass filtering, the memory usage of my GPU increases each training iteratio…
-
Steps to reproduce:
1. Run the command "module_search m/CS21009"
Expected: Invalid module code
Actual: List of students with module: CS21009
0 students listed!
 kommen viele Mails zurück mit dem …
-
fastplong -w 128 -Q -i ont.fq.gz -o fastplong.fq.gz
Trying to detect adapter sequence at read start
Detected: TGTACTTCGTTCAGTTACGTATTGCT
Trying to detect adapter sequence at read end
Found possib…