-
Hi, @egochao
It's very exciting that you provide a simple method to train and predict promoter sequences. This is friendly to us newbies in machine learning. I encountered some problems during use…
wq-ls updated
5 months ago
-
* a database schema with three datasets, each of the dataset has one basket
* since the import was done _without_ `--importBid` the t_ili_tid column is empty, see the database table:
![grafik](htt…
-
Oasis and fastMRI sequences have a lot in common.
To ease as much as possible the integration of other databases, the common backbone of these sequences should be extracted, and the current classes…
-
Hi,
as I cant use omxplayer, I wanted to change the code to use vlc.
When I pull and compile the solution using the VS19/22 CLI "dotnet publish --runtime linux-arm --self-contained" the build runs w…
-
`s3://nf-core-references`
`species/source/build/patch/tool/tool_version/annotation`
annotation/
databases/
indices/
sequences/
-
Was walking wolfgang listening to our chat about replication and this idea hit me.
The `seq` is utterly useless without `since` which I already said needs to be optional if we want to support databas…
-
I am testing CAI package following your instructions and I got a bug when processing small sequences. My sequence is:
```
>testseq
ATGAAATTAATATTGAAACTCGTGGAACGGAAAAAACTGATCAAGGAGTTAAAAGAAGATATTG…
-
Hello I'm writting because I'm facing when I run RepeatModeler.
Here is the code I used :
```
Sp_name=Tryphoninae_B
ASSEMBLY=/beegfs/data/these/Genomes/Tryphoninae_B/Tryphoninae_B.fa
c…
-
I would have two classes here: `OligoAttributesCalculator` (with the private functions) and `OligoDatabaseAttributes` which apply the functions to the database. The second one can have a common `_appl…
-
# Environment
Knex version: `0.21.19`
Database + version: PostgreSql
OS: macOS
Select applicable template from below.
If issue is about oracledb support, tag @ atiertant. For MSSql tag @ smor…