-
```
What version of Redis you are using, in what kind of Operating System?
2.2.11
What is the problem you are experiencing?
when I perform a ZADD with a score like: 20110802.4 the actual score writte…
-
```
What version of Redis you are using, in what kind of Operating System?
2.2.11
What is the problem you are experiencing?
when I perform a ZADD with a score like: 20110802.4 the actual score writte…
-
Hello~I have a question that's been bothering me for half a month now; I'd like to seek your advice on it. Why is it that when I use MEL images with hair removal and a size of 256x256 for StyleGAN3 tr…
-
### 🚀 The feature, motivation and pitch
I want to implement tree attention for vllm mentioned in [RoadMap](https://github.com/vllm-project/vllm/issues/3861). But I don’t know whether I should imple…
-
for (int i = 0; i < textBoxes.size(); ++i) {
Logger("TextBox[%d](+padding)[score(%f),[x: %d, y: %d], [x: %d, y: %d], [x: %d, y: %d], [x: %d, y: %d]]\n", i,
textBoxes[i].scor…
-
why in every seed the result always have score : 1 and Iteration: 0?
i think the score should be in decimals numbers
here is the mongodb result after running the code :
> db.reverb_wikipedia_100…
-
Hi,
The example code here uses an aligner with the following scoring scheme:
Match:2, Mismatch:-1, all_gaps_penalties=1
```
import ssw_aligner
query='CAGACAATCAGCATGTTTCCGGCAGCGCCGGTAG'
t…
-
Hi Douwe Schulte,
Thanks a lot for developing such a great tool which benefits the whole proteomics community!
I am using several de novo peptideing sequencing tools (including casanovo) that di…
-
**Is your feature request related to a problem? Please describe.**
Record card are awesome but the `vectors` don't add any value except forced scrolling.
**Describe the solution you'd like**
…
-
### Go version
$ go version go version go1.22.1 darwin/arm64
### Output of `go env` in your module/workspace:
```shell
GO111MODULE='auto'
GOARCH='arm64'
GOBIN=''
GOCACHE='/Users/jameslees/Librar…