-
**Is your feature request related to a problem? Please describe.**
INCEpTION is excellent when it comes to annotating relations and entities, but I don't find it suitable for text classification task…
-
Would it make sense to utilise PoET for binding affinity prediction (ic50 score) of short peptide sequences (8-16 amino acids)? If yes, do you have any suggestions/comments on how to do it? Is it poss…
-
Hi @GDKO,
it's me again @bheimbu. I have a question concerning the output of `avp prepare`…
```
query name donor ingroup AI HGTindex query hits number AHS outg_pct
229769_8676 Uniref90|UniRef9…
-
**Is your feature request related to a problem? Please describe.**
We usually interpret confidence scores as a proxy for the error estimate in the keypoints prediction. However, it is well known that…
sfmig updated
3 weeks ago
-
raceback (most recent call last):
File "/content/drive/MyDrive/BERT-BILSTM-CRF-main/main.py", line 193, in
main(data_name)
File "/content/drive/MyDrive/BERT-BILSTM-CRF-main/main.py", line 187, in …
-
Hi,
I have the following COI sequence:
>ASV2
TCTAAGTCATATTACGAGCCACTCTGGTGGTGCAGTTGATTTAGCTATTTTCAGTTTACATTTATCTGGAGCGAGCAGTATTTTAGGGGCGATTAACTTTATTACCACTATCTTTAACATGCGTGGGCCTGGTCTGGGCTTCCATCGC…
-
I wonder whether torchtune can support traditional tasks such as translation or more general text generation tasks which have a input and output column. I have read the datasets doc at [here](https://…
-
# Expected Behavior
I have provided the below command
**mmseqs expandaln ./base/qdb ./uniprot/uniprotdb.index ./base/res ./uniprot/uniprotdb.index ./base/res_exp --db-load-mode 2 --expansion-mode…
-
When running the pipeline, I get methylation classification results in the GUI, but there are several errors in the terminal. CNV data is missing, and I cannot generate a report from the GUI. I have a…
-
Hi Vuthuyduong,
I have followed your pipeline for the classification of some ASVs. My reads are ITS1 extracted, and I’ve used the ITS1 extracted UNITE v10 database that you prepared (thank you!). H…