-
Similar to what we have for flow diagram.
-
When using the Find tool dialog box, when you get to the last instance of that keyword found, another dialog box opens asking user if they want to "Wrap search and find again", if user chooses to do s…
-
Instead of doing global alignment on whole genome sequences, align just the searched subtype ORF sequence to the full query sequence.
The searched subtype ORF sequence should be prefixed and suffix…
-
-
**Describe the bug**
Occasionally, when searching for a sequence of bytes in hex, if your very first search fails it will cause all following searches that keep the first byte (possibly others) in th…
-
Create "Get All Rides" sequence diagram
-
Some tRNA sequences get a large number of hits which causes a problem for sequence search, for example this sequence currently crashes it: `GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUC…
-
related comment thread: https://github.com/slatedb/slatedb/pull/265#discussion_r1809637985
> @[flaneur2020](https://github.com/flaneur2020) [2 days ago](https://github.com/slatedb/slatedb/pull/265#…
-
### 🚀 The feature, motivation and pitch
In the advance_step.cu, there is a constraint on the number of sequences based on the number of available GPU threads and block_tables stride.
```
// …
-
Hi
Thanks for the great contributions here.
I have a fasta file containing 36 sequences, I am trying to do the homology search against uniprot, Here is what I did:
mmseqs databases UniProtKB db/un…