-
I start by testing if viability readouts in the PRISM assay for A549 are similar to cell health model estimates. The DepMap data are accessed [here](https://depmap.org/portal/download/all/?release=PRI…
-
Dear developers of SPOT-RNA,
I am excited to run this SPOT-RNA tool. I found this error `tensorflow.Example exceeds maximum protobuf size of 2GB`. Is there a length limit for the input sequence? I …
-
Hi,
I am trying to do a genome-wide target prediction for my sRNA sequence, by using the whole genome sequence as my target sequence. But I feel like it may not be the best approach as it is taki…
-
Hi, How is this scenario possible:
from Vienna package docs:
```
$ RNAsubopt -e 1 -s < test.seq
CUACGGCGCGGCGCCCUUGGCGA -500 100
...........((((...)))). -5.00
....((((...))))........ -4…
-
When two lines have the same "title" AND "year" AND "authors" keep only one (the first? the most complete?)
Below the three key in ISI and SCOPUS:
- title --> ISI = TI / Scopus = Title
- year -->…
tommv updated
3 years ago
-
**Recruitment open and in full swing by**: Dec. 10th 2019
- Aim for 2-3 industry-led teams. Recruitment for bioinformatics.
- [x] Prepare email advertisment for email-lists (including RNA Society …
-
Hey, thanks for a nice package. I want to find the most structured region per transcript. So I want the raw positional entropy values as output, but I can't find a way to get them. Only as input for c…
-
- DNA topoisomerase IV complex
- A heteromeric enzyme, which in most bacteriophage species is composed of multiple subunits. Functions in chromosome segregation and can relax supercoiled DNA.
- Cell…
-
Hi,
rnaEval yields -0.8 for GCGAGAC&GUGCGGC and ((...((&))...))
But if I apply the rules of the turner library 2004 I get -1.2.
The difference stems from the symmetric 3x3 internal loop:
…
-
Starting from e.g: https://github.com/hussius/deeplearning-biology or https://github.com/greenelab/deep-review select a set of models, rebuild and re-train them in Keras.
## Spreadsheet of models t…