-
Hello
I have a large protein sequence file as below, sum_len 10,885,629,915 bp.
```
> file format type num_seqs sum_len min_len avg_len max_len
> non…
KJ-Ma updated
7 months ago
-
Hi,
is is possible to find out the exact version of the sequence libraries at the remote mmseqs server used to build the msa when running colabfold_batch locally (https://github.com/YoshitakaMo/local…
-
The `msa_hmm` step combines two alignments into one file. Both the ingroup and the outgroup are processed separately to figure out the revcom orientation and do the alignment. The files are then simpl…
rvosa updated
2 months ago
-
Having successfully completed the Phyluce process with my raw data, I'm now trying to rerun the program with outgroup data downloaded from SRA. The new SRR sequences are raw but paired (it's unclear w…
-
It is sometimes useful to combine headers (particularly the reference sequence dictionaries) in order to write alignments from multiple input files to a single output file.
Suggestions for validat…
msto updated
10 months ago
-
## Bug Description
I tried to run it on the following fasta file it gives me this error:
```fasta
>seq-2
MKKKKKKKLKKLKKKLKKKLKKKKKLLLLLLLLKKKKKKK
>seq-9
MKKKIKKIKKKIEKKKKKKLKKLKKKKKKKKLLLLLLLLL
…
-
I'm trying to perform two alignments with AGAThA of sequences about 200bp each. Here are the input files I'm using:
`query_test.fasta`
```
>0
GGATATAGGGGTAGCACTTGATACGGTAGCGGGCTCATTGGAGCATCCGAAT…
quim0 updated
2 months ago
-
I ran into some issues with the pairwise alignment of sequences read from different files. Although the exact issue varies from case to case, it seems that the first alignment produces the correct res…
-
I have run just the following commands
mmseqs createdb x_protseqs.fasta x_db
mmseqs cluster x_db x_clust tmp --min-seq-id 0.9
mmseqs createtsv x_db x_db x_clust x_clust.tsv
My input x_protseq…
-
```
What steps will reproduce the problem?
1. prank -d=EOG78Q418.fa -o=EOG78Q418
2. Same problem whether using prank compiled from source or pre-made binary
3. prank works well for the vast majority o…