-
## WHAT
**Write** execution workflow for [MISO](http://hollywood.mit.edu/burgelab/miso/). Use the provided [small files for testing](https://github.com/iRNA-COSI/APAeval/tree/main/tests/test_data…
-
Some tool choices in RNAseq are a matter preference, in that the evidence is not clear enough to enable an empirically or theoretically motivated choice. However, some things are just demonstrably bad…
-
Hello everyone,
I have been using ASGAL for some time now and I'm very content with the obtained results, congrats on the implementation.
Lately I have been working with samples that present the [AL…
-
Hello,
I am running coverageBed to determine coverage of a specific regions of a genome by RAD tag data (restriction-site associated DNA reduced representation sequences). I am interested in the cove…
ghost updated
11 years ago
-
I test one example read (`CTGGCTGGAGCAGCGGGACCGCTCCATCCGAGAGAAGCAGAGTGATGATGAGGTTTATGCGCCAGGT`), and run STAR with `--alignSJDBoverhangMin 1` argument.
The last 3rd base *..TATGCGCCA***G** is the …
-
Dear Gotoh,
I'm struggling with getting a gff file from my transcripts and genome files.
I've run:
`makeidx.pl –ip path/to/genome.mfa`
`spaln -Q1 -O0 -t32 path/to/genome.mfa path/to/transcripts.mf…
-
Dear Brian,
I am trying to run PASA on HCP. I faced two problems.
1. I ran the sample as got the error as below. So, I think I can run on GMAP but had some problem on BLAT.
"-running pblat
.…
-
There is a new paper criticizing featureCount for not being able to quantify lncRNA expression effectively. Here is my summary of their paper:
1. featureCount under-estimated lncRNA expression compar…
-
Hello!
I've successfully gotten the .gamp file of the transcriptome file with `vg mpmap` and he seems to have no problem. But when I run rpvg, he has the following error:
Random number generator …
-
Hi, I'm doing **variant calling from my RNAseq** data on a cell line (Paired End 2X100b, Illumina)
I'm following GATK workflows and everything is working almost fine since I can find all the expected…