-
Dear @mjafin,
thank you for the tool, which is very helpful. However, I got stuck while splitting reads containing two or more `N` cigars:
```
18M2443N77M2449N5M TAGGGGCTCCCGCTGCAGCTCTTTCACTTCCACAAGA…
-
The first target I will attempt to synthesise is compound 1, this belongs to the triazolopyridine series 4 compounds
( OSM series 4 info http://openwetware.org/wiki/OpenSourceMalaria:Triazolopyrazine…
-
Proposal of 2 new terms and maybe some
obsolescences as well, relating to heterotrimeric
and small monomeric G proteins.
SGD had genes annotated to each of three terms
that recently went obsolete:
h…
-
Proposal of 2 new terms and maybe some
obsolescences as well, relating to heterotrimeric
and small monomeric G proteins.
SGD had genes annotated to each of three terms
that recently went obsolete:
h…
-
Hi,
I'm testing VarDict Java on bcbio-nextgen's integration test data and it's dying out on me likely due to edge cases:
```
Exception in thread "main" java.lang.NullPointerException
at com.a…
-
Thanks for the work on the VarDict java port. The speed improvements are very
welcome, and I've been working on validating the latest version (1.2.1) against
the DREAM ICGC-TCGA challenge data used pr…
-
I am running the variant2 pipeline for exon samples. Everything seemed to be running fine until some error messages popped up:
First I get lots of errors - I think it is during the vardict task.
```…
-
Hi folks,
as well as waiting for biological testing on OSM-S-106 and [The twisted analogue](https://github.com/OpenSourceMalaria/OSM_To_Do_List/issues/161), I have already had good interest in the Ma…
-
Hi Zhongwu,
Could you fix lines
https://github.com/AstraZeneca-NGS/VarDict/blob/master/var2vcf_valid.pl#L65
and
https://github.com/AstraZeneca-NGS/VarDict/blob/master/var2vcf_valid.pl#L66
to adhere to…
-
We've been working on an updated version of our comparison of a battery of test systems across OpenMM platforms to ensure that potential energies and forces agree.
We recently updated our test for Sr…