-
Hi,
Is there a way that the user could change the Blast search settings inside the box from Tools -> search sequence?
Thank you in advance,
Michal
-
Hello @kimrutherford and @ValWood, first congrats on managing to pass the submission pipeline!
I noticed that the new submission no longer includes the mitochondrial chromosome sequence. I know tha…
-
### Is there an existing issue for this?
- [X] I have searched the existing issues
### Current Behavior
While running the following script in a docker-compose context the logs succeed when cr…
-
Hi,
When I running this command :
`vcf2maf=/data/jiaf/wes_cancer/biosoft/vcf2maf/vcf2maf.pl
vep_path=~/miniconda3/envs/vep/bin/
GENOME=/data/jiaf/wes_cancer/biosoft/gsutil/gatk/hg19/v0/Homo_sapie…
-
GDB showed me I get a segmentation fault [here](https://github.com/soedinglab/MMseqs2/blob/master/src/util/convertalignments.cpp#L33C68-L33C88)
```#0 0x0000555555f577fe in printSeqBasedOnAln (out=…
-
I would love if it was possible to search for mutations by ambiguity codes. Something like S:T500X would that would return sequences containing ANY mutation at that residue. Essentially how many seque…
-
```
We need to be able to search for text in the current window (e.g. the
current chapter, dictionary entry, ...). Search should use a standard
highlighted incremental search and key sequence (scroll…
-
### Describe the bug
I seem to drop combos more often in the latest Ikemen nightly build (12-22-23) when compared to Mugen 1.1.
### To Reproduce
1. Download G from here: https://mega.nz/file/rN…
-
Hi,
When I do the gRNA design for short sequence where only 2-3 gRNA exist, it worked very well. However, when I increased the input sequence length and there were 19 gRNA, the scores and the numbe…
-
Search for shRNA sequence GTGAAGAATGTGACAAAGTTT finds two observations, but from the search page it is not possible to go to shRNA page https://ctd2-dashboard.nci.nih.gov/dashboard/#rna/gtgaagaatgtgac…