-
## Summary
Documentation on how to use the Sword2 integration would be helpful for the pals team and their users
## Acceptance Criteria
- [ ] Documentation on how to use Sword2 integration is rec…
-
I was wondering how STAR development will continue with regard to the new GRCh38/hg38 assembly and the existence of ALT contigs ([Reference 1](https://www.biostars.org/p/59126/) [Reference 2](http://w…
-
Exactly as the title says. Tested on RHEL and Ubuntu, I don't see syslogs colorized.
-
EL6695 has a virtual RxPDO (0x1608) and a virtual TxPDO (0x1A08).
Is there any plan for support virtual PDO?
-
Hi Alex,
I am trying to map RNAseq data from infected specie to a viral genome, so i generated my genome index without annotation and then did the mapping, i get an SJ.out.tab with 9 columns that …
-
I used 2GB data of illumina reads.
the assembly resulted in all folders. but mapping is only completed, spades and fininshed assembly folders are empty.
Sample: deru
Fast-Plast Version: Fast-P…
-
As currently written, it appears you can only do about 93 SPS. It looks like if there is a shorter delay introduced on analog_read, it drastically increases the sampling rate and it seems to be runni…
-
When we use STAR to map the results of targeted sequencing we merge the gencode annotation with specific amplicons we use for targeted amplification. (We design primers close to polyA site in the 3-pr…
-
Hi
We have used Star (version 2.7.9a) to map paired-end reads, and obtained the following Log.final.out file:
```
Started job on | Jul 06 08:01:20
…
-
Hi,i have a problem when i do mapping
i have two fq like this:
R1:
@A00869:204:H3VMVDSXY:1:1106:29134:7451 1:N:0:ATTAGAC+CGTCTAAT
GCCATGTTGGTGCCAGATATTGGGGAACAGGAAGCTGTATTGACTGCTGAAAGTATCATCAGTCCT…