-
### IOF Council meeting (187) minutes published!
New ISSOM draft (ISSOM 2018 ?) coming soon!
- Post - http://orienteering.org/council-meeting-minutes-187-published
- PDF - http://orienteering.o…
ghost updated
3 weeks ago
-
Hello
Is a release with [4.x java driver](https://github.com/datastax/java-driver) planned?
If so, do you have a target date in mind?
Thanks a lot for your feedback
Best regards
-
Hi, I am using Cutadapt 4.9 in a Conda environment
this is the paired end reads sequencing by Novogene Illumina TruSeq Dual Index, I followed the command line
` cutadapt -a AGATCGGAAGAGCACACGTC…
-
When reading WARC files compressed with gzip, many of the entries contained are skipped or misread. To reproduce, use common crawl data in .gz format, count the number of entries found by the WARC lib…
-
Hi, I am trying to run ALLHiC_corrector, but get the following error. DO you have any recommendations?
[13:29:17] Contig: ptg000402l Getting mapping list
[13:29:17] Contig: ptg001136l Ge…
-
```
Hi,
this is not a bug report, but a feature request for a small but important
improvement:
cryptsetup luksOpen
can only open one device at a time. This means that you have to enter the
pa…
-
This is probably still #15533, but making a separate issue just in case.
### System information
Type | Version/Name
--- | ---
Distribution Name | NixOS
Distribution Version | 23.11
Kernel V…
delan updated
2 weeks ago
-
```
0:00:00.000 4M / 4M INFO General (main.cpp : 76) Loading config from /scratch/mygenome__SPAdes3.11.1_noecc_ramdisk/K55/configs/config.info
0:00:…
-
When I started to run the function counts
-
See https://github.com/hibernate/hibernate-ogm/blob/master/core/src/main/java/org/hibernate/ogm/exception/impl/Exceptions.java
This will give better stacktraces to callers of generated mapper impleme…