-
k-mer trimming and diginorm should happen on the full `sample`, not each `sample-unit` pair of files. We now have a function to do this (currently in the salmon rule) that can now be moved forward.
…
-
Hi,
So our team is using combinatorial sequencing with multistep barcode appends. Thus our read analysis pipeline uses pipe and multiple cutadapt calls. Thus, somewhere in the source code a for loo…
-
The image looks all wrong:
Can you please take a look at my implementation and see if I'm missing anything?
```
import korlibs.image.bitmap.Bitmap
import korlibs.image.color.RGBA
import k…
-
This issue appears not to be very minor for the pyboard or any board using 64- or 100-pin versions of the STM32F405, so it could be low-priority or 'won't fix'. However, I encountered this running Mic…
-
Undefined symbols for architecture x86_64:
"_lame_close", referenced from:
-[TXXViewController toMp3] in TXXViewController.o
"_lame_encode_buffer_interleaved", referenced from:
-[TXXVi…
-
@quantombone Thanks for putting together the docs on getting boot2 running, you're awesome.
I tried running the youtube script and get the following:
```
Stream mapping:
Stream #0:0 -> #0:0 (h264…
-
Hello, sorry for the empty previous post cuz I tapped Enter key so fast...
I am preparing datasets for kmernorm which requires the files look like
@seq_1/1
AAAAAAAACCCCCCCTTTTTTTTTGGGGGGGG
+
&&&&&&&&…
-
### Motivation
We're using the recent (5.9.2) backtrace support on Linux to monitor our service. Due to noise in the logging, a backtrace can be hard to assemble when it's interleaved with other mess…
-
EDIT: this was https://github.com/thesofproject/sof/issues/9067, now transferred to sof-test
**Describe the bug**
SOF commit [c77a4feb2f1f15a3a29edf49b091b4b4a507be48](https://github.com/thesofpro…
-
The C64 serial bus is very slow. My usual workaround is to use my IEEE488 interface for any serious work (which is also supported by GeckOS of course :-)
However, not everyone has this, so maybe we…