search

gxelab / psite

Model-based inference of P-site offsets for ribosome footprints
MIT License
3 stars 0 forks source link
bioinformatics deep-sequencing machine-learning

readme

PSite

DOI

PSite is a python package that predicts P-site offsets for footprints generated in ribosome profiling using a Gradient Boosting Trees (GBT) model trained with footprints around both annotated start and stop codons. PSite can report estimated P-site offsets in two manners:

To demonstrate the usage of the PS tag, PSite also has a coverage module that performs genome-wide calculation of P-site coverage of ribosome footprints at nucleotide resolution.

Dependency

Note: pandas 2.0 is supported now.

Install and uninstall

To install PSite, run

pip install psite

Alternatively, download the package tarball from the release page and run

pip install psite-version-py3-none-any.whl

To uninstall it, simply run

pip uninstall psite

Build distributions from source

Run the following command in the source directory

python3 -m build

Usage

PSite is designed to be used from the command line on Unix-like operating systems such as Linux or macOS.

$ psite -h
Usage: psite [OPTIONS] COMMAND [ARGS]...

  main interface

Options:
  -h, --help  Show this message and exit.

Commands:
  coverage  calculate the coverage for plus strand and minus strand...
  pbam      generate bam with only P-site regions
  predict   load pre-trained model and predict P-site offsets
  setp      set global fixed P-site offset tag
  train     train a model for P-site offset prediction

train

The core module that trains the GBT model for P-site offset prediction. It requires transcriptome alignments (PATH_BAM) and the corresponding sequences of all transcripts (PATH_REF). The required bam can be generated by mapping footprints to the reference genome using STAR and output transcriptome alignments with parameter --quantMode TranscriptomeSAM. The trained model is saved in pickle format for later use.

$ psite train -h
Usage: psite train [OPTIONS] PATH_REF PATH_BAM OUTPUT_PREFIX PATH_TXINFO

  train a model for P-site offset prediction

  path_ref     : reference transcriptome (fasta) matching the bam
  path_bam     : alignments of RPFs to reference transcriptome
  output_prefix: output prefix of fitted models and logs
  path_txinfo  : transcriptome annotation

Options:
  -t, --type_rep [longest|principal|kallisto|salmon]
                                  type of representative transcripts
                                  [default: longest]
  -e, --path_exp TEXT             path of transcript expression quant results
  -i, --ignore_txversion          ignore transcript version in
                                  ".\d+" format  [default: False]
  -n, --nts INTEGER               flanking nucleotides to consider at each side
                                  [default: 3]
  -f, --frac FLOAT                fraction of alignments for training (for
                                  large datasets)  [default: 1.0]
  --offset_min INTEGER            lower bound of distance between RPF 5p and
                                  start codon  [default: 10]
  --offset_max INTEGER            upper bound of distance between RPF 5p and
                                  start codon  [default: 14]
  -d, --max_depth INTEGER         max depth of trees  [default: 3]
  -m, --min_samples_split INTEGER
                                  min number of alignments required to split
                                  an internal node  [default: 6]
  -k, --keep                      whether to keep intermediate results
                                  [default: False]
  -h, --help                      Show this message and exit.  [default:
                                  False]

predict

This module predicts P-site for each alignment using a pre-trained model and append a PS tag (for "P-site") to the original alignment. The input can be either genomic alignments or transcriptomic alignments.

$ psite predict -h
Usage: psite predict [OPTIONS] PATH_REF PATH_BAM PATH_MODEL PATH_OUT

  load pre-trained model and predict P-site offsets

  path_ref   : reference transcriptome (fasta) matching the bam
  path_bam   : alignments of RPFs to reference transcriptome
  path_model : path to save the fitted model
  path_out   : output path of bam with PS (for P-site) tag

Options:
  -i, --ignore_txversion    ignore transcript version in ".\d+"
                            format  [default: False]
  -l, --rlen_min INTEGER    lower bound for mapped read length
  -u, --rlen_max INTEGER    upper bound for mapped read length
  -c, --chunk_size INTEGER  chunk size for prediction batch  [default: 100000]
  -h, --help                Show this message and exit.  [default: False]

pbam

This module predicts P-site for each alignment and keeps only the first nucleotide after excluding the P-site offset. Thus, each alignment in the output contains a single site. The input can be either genomic alignments or transcriptomic alignments.

$ psite pbam -h
Usage: psite pbam [OPTIONS] PATH_REF PATH_BAM PATH_MODEL PATH_OUT

  generate bam with only P-site regions

  path_ref   : reference transcriptome (fasta) matching the bam
  path_bam   : alignments of RPFs to reference transcriptome
  path_model : path to save the fitted model
  path_out   : output path of bam with P-site regions only

Options:
  -f, --out_format [bam|sam]  P-site alignment output format  [default: bam]
  -i, --ignore_txversion      ignore transcript version in ".\d+"
                              format  [default: False]
  -l, --rlen_min INTEGER      lower bound for mapped read length
  -u, --rlen_max INTEGER      upper bound for mapped read length
  -c, --chunk_size INTEGER    chunk size for prediction batch  [default:
                              100000]
  -h, --help                  Show this message and exit.  [default: False]

coverage

This module calculates the genome or transcriptome-wide coverage of RPF P-sites using the PS tag generatd by predict module.

$ psite coverage -h
Usage: psite coverage [OPTIONS] PATH_BAM PREFIX

  calculate the coverage for plus strand and minus strand separately

  path_bam: sorted alignment bam file with the PS tag (for P-site offset)
  prefix  : output prefix of P-site coverage tracks in bigWig format

Options:
  -l, --rlen_min INTEGER  lower bound for RPF mapped length  [default: 25]
  -u, --rlen_max INTEGER  upper bound for mapped read length  [default: 40]
  -q, --mapq_min INTEGER  minimum mapping quality  [default: 10]
  -i, --ignore_supp       whether to ignore supplementary alignments
                          [default: False]
  -h, --help              Show this message and exit.  [default: False]

setp

This module sets a global fixed value for the "PS" tag.

$ psite setp -h
Usage: psite setp [OPTIONS] PATH_BAM PATH_OUT

  set global fixed P-site offset tag

  path_bam   : alignments of RPFs to reference transcriptome
  path_out   : output path of bam with PS (for P-site) tag

Options:
  -l, --rlen_min INTEGER     lower bound for mapped read length  [default: 27]
  -u, --rlen_max INTEGER     upper bound for mapped read length  [default: 35]
  -n, --nucleotides INTEGER  fixed global offset value  [default: 12]
  -h, --help                 Show this message and exit.

An example workflow to use PSite

Prepare input files

After trimming adapters and optionally removing reads derived from rRNAs or tRNAs, map ribosomal footprints to the reference genome with STAR:

STAR --runThreadN 16 --outFilterType BySJout --outFilterMismatchNmax 2 --genomeDir genome_index --readFilesIn sample_RPF.fq.gz  --outFileNamePrefix sample_RPF --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM --outFilterMultimapNmax 1 --outFilterMatchNmin 16 --alignEndsType EndToEnd --outSAMattributes NH HI AS nM NM MD

The parameter --quantMode TranscriptomeSAM will instruct STAR to translate the genomic alignments into transcript alignments, which will be used to train the GBT model. Since many uniquely mapped reads in genomic alignments will become multi-mapping reads in transcriptome alignment due to the presence of alternative transcript isoforms, --outFilterMultimapNmax 1 parameter is included to exlude only multi-mapping reads in genomic alignments.

PSite needs to know the position of annotated start codons and stop codons of all protein-coding transcripts, which can be obtained with the helper scripts located in the scripts directory:

Rscript --vanilla scripts/extract_txinfo_ensembl.R gene_annotations.gtf txinfo.tsv

Only a represent isoform is used in the analysis for a gene with multiple transcript isoforms. By default, PSite uses the longest transcript. However, a more reasonable choice is the most abundant isoform. Therefore, if the information of transcript abundance as calculated by kallisto or salmon is provided, PSite can automatically determine the most abundant transcript isoform for later use:

salmon quant -p4 --seqBias --gcBias --posBias -l A -i salmon_index -r sample_RNA.fq.gz -o salmon_results
Run PSite

The first step is to train a GBT model with train module with the transcriptome bam. Then, the fitted model will be saved in pickle format.

psite train -i -t salmon -e salmon_results/quant.sf \
    all_transcripts.fa sample_RPF.Aligned.toTranscriptome.out.bam output_prefix txinfo.tsv

Model training is slow for large datasets. -f parameter can be used to select only a subset of alignments for training. This can significantly improve speed and reduce memory usage while maintaining similar accuracy.

Once the model is successfully trained, it can be used to predict P-site offsets for ribosome footprints that are mapped to the reference genome or reference transcriptomes. It should be noted that if you use genome bam for prediction, genomic fasta should be used as input, and vice versa.

# with transcriptomic bam
psite predict -i all_transcripts.fa sample_RPF.Aligned.toTranscriptome.out.bam output_prefix.gbt.pickle sample_RPF.transcriptome.tag.bam

# with genomic bam
psite predict -i genome.fa sample_RPF.Aligned.sortedByCoord.out.bam output_prefix.gbt.pickle sample_RPF.genome.tag.bam

example output:

r1  16  2L  10716   255 29M *   0   0   TACAATTTATTAAATGGGGACGGACCAAT   IIIIIIIIIIIIIIIIIIIIIHIIDDDDD   NH:i:1  HI:i:1  AS:i:28 nM:i:0  NM:i:0  MD:Z:29 jM:B:c,-1   jI:B:i,-1   PS:i:10
r2  16  2L  10836   255 33M *   0   0   TGTCAACTTTTATCCTTTGTACCTTTCTACAAA   IIIIIIIIIIIIIIIIIIIIIIIIIIIIDDDDD   NH:i:1  HI:i:1  AS:i:32 nM:i:0  NM:i:0  MD:Z:33 jM:B:c,-1   jI:B:i,-1   PS:i:12
r3  16  2L  10891   255 30M *   0   0   CGGGTAAAGGGTATAAAGTCACTACGCGAA  GGD1HEC?HHIHHGF<1?IHHDHHF0@DD0  NH:i:1  HI:i:1  AS:i:29 nM:i:0  NM:i:0  MD:Z:30 jM:B:c,-1   jI:B:i,-1   PS:i:12
r4  16  2L  11027   255 31M *   0   0   TTTCTGTTTGTATGTAAATCGCGTTTAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIDDDDD NH:i:1  HI:i:1  AS:i:30 nM:i:0  NM:i:0  MD:Z:31 jM:B:c,-1   jI:B:i,-1   PS:i:12
r5  16  2L  11073   255 32M *   0   0   CGTTCCTATTTTGCTGTCCCCGTTCGATTTTT    IHHIIIIIIIIIIIIIIHIIIIHIIIIDDDDD    NH:i:1  HI:i:1  AS:i:31 nM:i:0  NM:i:0  MD:Z:32 jM:B:c,-1   jI:B:i,-1   PS:i:12
r6  16  2L  11077   255 29M *   0   0   CCTATTTTGCTGTCCCCGTTCGATTTTTA   @CC?FCD<<CG</H@HDHHHIHCF0?@@D   NH:i:1  HI:i:1  AS:i:28 nM:i:0  NM:i:0  MD:Z:29 jM:B:c,-1   jI:B:i,-1   PS:i:12
r7  16  2L  11132   255 31M *   0   0   AAATTACATCAGGACTAGTACTCGTTTGCGT IIIHIIHIIIIIHIHIIIHHIGIIIIDDDBD NH:i:1  HI:i:1  AS:i:30 nM:i:0  NM:i:0  MD:Z:31 jM:B:c,-1   jI:B:i,-1   PS:i:11
r8  16  2L  11138   255 32M *   0   0   CATCAGGACTAGTACTCGTTTGCGTCGTATTT    1HHHIIHIHGIHIIIIIIHHIIHGGHHDDD@@    NH:i:1  HI:i:1  AS:i:31 nM:i:0  NM:i:0  MD:Z:32 jM:B:c,-1   jI:B:i,-1   PS:i:12
r9  16  2L  11138   255 29M *   0   0   CATCAGGACTAGTACTCGTTTGCGTCGTA   CFEGFHFCIHIHIIIHDIGIIHCHD<BB?   NH:i:1  HI:i:1  AS:i:28 nM:i:0  NM:i:0  MD:Z:29 jM:B:c,-1   jI:B:i,-1   PS:i:10
r10 16  2L  11140   255 32M *   0   0   TCAGGACTAGTACTCGTTTGCGTCGTATTTCT    FCCHHCHIHIHHE0HHHDECHIH?IHG@0@D@    NH:i:1  HI:i:1  AS:i:31 nM:i:0  NM:i:0  MD:Z:32 jM:B:c,-1   jI:B:i,-1   PS:i:13

It is also possible to output alignments with P-site locations only, which can be used for downstream applications such as translated ORF prediction with RibORF.

psite pbam -f sam genome.fa sample_RPF.Aligned.sortedByCoord.out.bam output_prefix.gbt.pickle sample_RPF.genome.psite.sam

Here are a few lines from an example output:

r1      16      1       531180  255     1M      *       0       0       G       J       NH:i:1  HI:i:1  AS:i:30 nM:i:0  NM:i:0  MD:Z:31
r2      16      1       531180  255     1M      *       0       0       G       J       NH:i:1  HI:i:1  AS:i:30 nM:i:0  NM:i:0  MD:Z:31
r3      0       1       629921  255     1M      *       0       0       A       J       NH:i:1  HI:i:1  AS:i:31 nM:i:1  NM:i:1  MD:Z:0C33
r4      0       1       629921  255     1M      *       0       0       A       J       NH:i:1  HI:i:1  AS:i:31 nM:i:1  NM:i:1  MD:Z:0C33
r5      0       1       629922  255     1M      *       0       0       T       J       NH:i:1  HI:i:1  AS:i:32 nM:i:0  NM:i:0  MD:Z:33
r6      0       1       629922  255     1M      *       0       0       T       J       NH:i:1  HI:i:1  AS:i:29 nM:i:1  NM:i:1  MD:Z:0C31
r7      0       1       629922  255     1M      *       0       0       T       J       NH:i:1  HI:i:1  AS:i:29 nM:i:1  NM:i:1  MD:Z:0C31
r8      0       1       629922  255     1M      *       0       0       T       J       NH:i:1  HI:i:1  AS:i:29 nM:i:1  NM:i:1  MD:Z:0C31
r9      0       1       629922  255     1M      *       0       0       T       J       NH:i:1  HI:i:1  AS:i:32 nM:i:0  NM:i:0  MD:Z:33
r10     0       1       629922  255     1M      *       0       0       T       J       NH:i:1  HI:i:1  AS:i:30 nM:i:1  NM:i:1  MD:Z:0C32

PSite also has a module for fast calculation of genome or transcriptome P-site coverage of ribosome footprints. The alignments should be sorted by coordinates before coverage calculation.

# sort bam
samtools sort -@ 8 -O bam -o sample_RPF.genome.tag.sorted.bam sample_RPF.genome.tag.bam

# calculate coverage
psite coverage sample_RPF.genome.tag.sorted.bam sample_RPF.psite_cov

NEW: a complete example of how to run PSite and use PSite output for downstream analyses is available from the repository associated with PSite manuscript.

Other information

Please use the issues panel for questions related to PSite, bug reports, or feature requests. If you use psite in your work, you can cite it as follows:

Chang, Y., Lei, T., Zhang, H., 2023. PSite: inference of read-specific P-site offsets for ribosomal footprints. bioRxiv, 2023.2006.2027.546788. https://doi.org/10.1101/2023.06.27.546788.