-
Running the stand-alone version of `gemelli` on the example data used in the tutorial I get the error `ValueError: No more features left. Check to make sure that the sample names between `sample-meta…
-
Hi Joey711,
Hope my message is in the right place, it's not directly a phyloseq problem but I think this may be of interest for other phyloseq users, and that at least, someone reading these posts …
-
I trying to do a simple test , but I don't understand how fasta header are proccess.
For exemple, I have One sample test.fa with the following reads :
```
>A_sample1
AGATACAAGATACAAGATACAAGATACAAGA…
dridk updated
5 years ago
-
`A user interacts with a contingency table to perform common ecological statistics including rarefaction, alpha, and beta diversity`.
- [ ] move the useful parts of the biom table API (#848)
- [ ] int…
-
Hi,
I am looking to do further downstream analysis of the bracken data using Qiime. Do you guys happen to have a conversion script that can output a biom format table from the bracken output ?
…
-
The output is currently delimited by ";" when it was and should be "; "
-
Hi @zachary-foster!
Thanks so much for your package!
I'm trying to parse the taxonomic information output from QIIME, and I am wondering the best way to do this. With command line tools I have a…
-
Pulling data from (https://docs.qiime2.org/2019.1/tutorials/importing/)
download.file("https://data.qiime2.org/2019.1/tutorials/importing/feature-table-v100.biom",destfile = "feature-table-v100.bio…
-
I got the following message when running predict_traits.py:
predict_traits.py -i ./genome_prediction/format/16S/trait_table.tab -t ./genome_prediction/format/16S/reference_tree.newick -r ./genome_pre…
-